List of products by brand Signalchem

Filter By
PKC Lipid Activator, 10x PKC Lipid Activator, 10x

PKC Lipid Activator, 10x

Reference: L51-39-500
€0.00 (tax incl.)
10x stock solution used for assaying protein kinase activity of PKC family members. Vortex or sonicate prior to use.
3CLpro FRET Substrate 3CLpro FRET Substrate

3CLpro FRET Substrate

Reference: CL01-58-500
€0.00 (tax incl.)
Synthetic FRET peptide substrate specific for 3CLpro.
3CLpro FRET Substrate 3CLpro FRET Substrate

3CLpro FRET Substrate

Reference: CL01-58-1000
€0.00 (tax incl.)
Synthetic FRET peptide substrate specific for 3CLpro.
AKT (PKB) Substrate AKT (PKB) Substrate

AKT (PKB) Substrate

Reference: A05-58
€0.00 (tax incl.)
The AKT (PKB) Substrate peptide sequence (CKRPRAASFAE) is based on the N-terminus of GSK3.
AKT (SGK) Substrate AKT (SGK) Substrate

AKT (SGK) Substrate

Reference: A08-58
€0.00 (tax incl.)
The AKT (SGK) Substrate peptide sequence (RPRAATF) is based on the N-terminus of GSK3.
CK2 Substrate CK2 Substrate

CK2 Substrate

Reference: C08-58
€0.00 (tax incl.)
The synthetic peptide (RRRADDSDDDDD) contains serine protein kinase phosphorylation site surrounded by acidic residues and is high selectively evaluated as a substrate for CK2 family kinases.
GSK3 Substrate GSK3 Substrate

GSK3 Substrate

Reference: G50-58
€0.00 (tax incl.)
The GSK3 sub peptide sequence (YRRAAVPPSPSLSRHSSPHQ(pS)EDEEE) is based on human muscle glycogen synthase 1 (amino acid 636-661).
HER2 Substrate HER2 Substrate

HER2 Substrate

Reference: E27-58
€0.00 (tax incl.)
The HER2 Substrate synthetic peptide [AAEEIYAARRG] is routinely evaluated as a substrate for HER2.
Modified AKT Substrate Modified AKT Substrate

Modified AKT Substrate

Reference: A05-58B
€0.00 (tax incl.)
The Modified AKT Substrate peptide sequence (modified-CKRPRAASFAE) is based on the N-terminus of GSK3.
Modified AKT Substrate II Modified AKT Substrate II

Modified AKT Substrate II

Reference: A05-58C
€0.00 (tax incl.)
The Modified AKT Substrate II peptide sequence (modified-CKRPRAASFAE) is based on the N-terminus of GSK3.
Modified AXLtide Substrate Modified AXLtide Substrate

Modified AXLtide Substrate

Reference: A16-58B
€0.00 (tax incl.)
The Axltide peptide sequence (CKKSRGDYMTMQIG) is based on the mouse Insulin receptor substrate 1 (amino acid 979-989).
Modified PKA Substrate Modified PKA Substrate

Modified PKA Substrate

Reference: C01-58B
€0.00 (tax incl.)
The modified PKA Substrate peptide sequence (modified-CGRTGRRNSI-amide) is based on the cAMP-dependent protein kinase inhibitor alpha (amino acid 15-23).
p38 Substrate p38 Substrate

p38 Substrate

Reference: P03-58
€0.00 (tax incl.)
The synthetic peptide (IPTTPITTTYFFFKKK) contains serine/threonine protein kinase phosphorylation sites and is routinely evaluated as a substrate for p38 family kinases.
PKA Substrate PKA Substrate

PKA Substrate

Reference: C01-58
€0.00 (tax incl.)
The PKA sub peptide sequence (CGRTGRRNSI-amide) is based on the cAMP-dependent protein kinase inhibitor alpha (amino acid 15-23).
PLpro FRET Substrate PLpro FRET Substrate

PLpro FRET Substrate

Reference: PL01-58-500
€0.00 (tax incl.)
Synthetic FRET peptide substrate specific for PLpro.
PLpro FRET Substrate PLpro FRET Substrate

PLpro FRET Substrate

Reference: PL01-58-1000
€0.00 (tax incl.)
Synthetic FRET peptide substrate specific for PLpro.
PP1/PP2A Substrate PP1/PP2A Substrate

PP1/PP2A Substrate

Reference: P50-58-1000
€0.00 (tax incl.)
The PP1/PP2A Substrate peptide [GRPRTS(p)SFAEG] is derived from human GSK3b (glycogen synthase kinase-3 beta) (amino acids 3-13) and is suitable as PP1 and PP2A substrate.
PP2B Substrate PP2B Substrate

PP2B Substrate

Reference: P51-58-1000
€0.00 (tax incl.)
The PP2B Substrate peptide [DLDVPIPGRFDRRV(p)SVAAE] is derived from bovine PRKAR2A (cAMP-dependent protein kinase type II-alpha regulatory subunit) (amino acids 82-100) and is suitable as PP2B substrate.
RSK Substrate RSK Substrate

RSK Substrate

Reference: S06-58
€0.00 (tax incl.)
The RSK sub peptide sequence (KRRRLSSLRA) is based on human 40S ribosomal protein S6 (amino acid 230-239).
S6K Substrate S6K Substrate

S6K Substrate

Reference: S05-58
€0.00 (tax incl.)
The S6K sub peptide sequence (KRRRLASLR) is based on human 40S ribosomal protein S6 (amino acid 230-238).
SRC Substrate SRC Substrate

SRC Substrate

Reference: S30-58
€0.00 (tax incl.)
The SRC sub peptide sequence (KVEKIGEGTYGVVYK-amide) is based on the p34cdc2 (amino acid 6-20).
Tyrosine Kinase Substrate-3 Tyrosine Kinase Substrate-3

Tyrosine Kinase Substrate-3

Reference: T71-58
€0.00 (tax incl.)
The synthetic peptide Tyrosine Kinase Substrate-3 (RRLIEDAEYAARG) is derived from human SRC (amino acid 412-422) and considered to be a generic substrate for various protein tyrosine kinases.
DUB Substrate I DUB Substrate I

DUB Substrate I

Reference: U06-57-10
€0.00 (tax incl.)
The ubiquitin-based proluciferin substrate is based on the C-terminal derivative of Ubiquitin.
DUB Substrate II DUB Substrate II

DUB Substrate II

Reference: S293-57-10
€0.00 (tax incl.)
The SUMO1-based proluciferin substrate is based on the C-terminal derivative of SUMO1.
DUB Substrate III DUB Substrate III

DUB Substrate III

Reference: N263-57-10
€0.00 (tax incl.)
The NEDD8-based proluciferin substrate is based on the C-terminal derivative of NEDD8.
DNMT Substrate-1 DNMT Substrate-1

DNMT Substrate-1

Reference: D53-58-05
€0.00 (tax incl.)
The synthetic double-stranded oligonucleotide (Sense: 5’- GATCCGACGACGACGCGCGCGCGACGACGAGATC; Anti-sense: 5’- GATCTCGTCGTCGCGCGCGCGTCGTCGTCGGAC) is used as a substrate for DNA methyltransferase 3A (DNMT3A).
METTL3/METTL14 Substrate METTL3/METTL14 Substrate

METTL3/METTL14 Substrate

Reference: M323-58-025
€0.00 (tax incl.)
The synthetic single-stranded 27 base’s oligo ribo-nucleotide is used as a substrate for assay of methyltransferase METTL3/METTL14 complex.
Poly (1:1 dI, dC) Acid Poly (1:1 dI, dC) Acid

Poly (1:1 dI, dC) Acid

Reference: P62-58-25
€0.00 (tax incl.)
The synthetic poly (deoxyinosinic-deoxycytidylic) acid sodium salt – double-stranded polymer (synthesized as 1:1 ratio) is used as a substrate for DNA methyltransferases.
PI(3)P PI(3)P

PI(3)P

Reference: P421-59-05
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(3)P PI(3)P

PI(3)P

Reference: P421-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(3)P:PS PI(3)P:PS

PI(3)P:PS

Reference: P426-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(3)P:PS PI(3)P:PS

PI(3)P:PS

Reference: P426-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4)P PI(4)P

PI(4)P

Reference: P422-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4)P PI(4)P

PI(4)P

Reference: P422-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4)P:PS PI(4)P:PS

PI(4)P:PS

Reference: P427-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4)P:PS PI(4)P:PS

PI(4)P:PS

Reference: P427-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4,5)P2 PI(4,5)P2

PI(4,5)P2

Reference: P424-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4,5)P2 PI(4,5)P2

PI(4,5)P2

Reference: P424-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4,5)P2:PS PI(4,5)P2:PS

PI(4,5)P2:PS

Reference: P429-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4,5)P2:PS PI(4,5)P2:PS

PI(4,5)P2:PS

Reference: P429-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(5)P PI(5)P

PI(5)P

Reference: P423-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(5)P PI(5)P

PI(5)P

Reference: P423-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(5)P:PS PI(5)P:PS

PI(5)P:PS

Reference: P428-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(5)P:PS PI(5)P:PS

PI(5)P:PS

Reference: P428-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI:PS PI:PS

PI:PS

Reference: P425-59B-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI:PS PI:PS

PI:PS

Reference: P425-59B-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
D-Fructose-6-phosphate D-Fructose-6-phosphate

D-Fructose-6-phosphate

Reference: F520-59-10
€0.00 (tax incl.)
D-Fructose-6-phosphate (sodium salt hydrate) is supplied as a crystalline solid.
D-Glucose-6-phosphate D-Glucose-6-phosphate

D-Glucose-6-phosphate

Reference: F521-59-10 mg
€0.00 (tax incl.)
D-glucose-6-phosphate (sodium salt) is supplied as a crystalline solid.
Abltide Abltide

Abltide

Reference: A02-58-1000
€0.00 (tax incl.)
The Abltide peptide sequence (EAIYAAPFAKKK) is based on the C-terminus of Abl.
Acetylated Histone H3 Peptide I Acetylated Histone H3 Peptide I

Acetylated Histone H3 Peptide I

Reference: H12-358-500
€0.00 (tax incl.)
The Acetylated Histone H3 (K9, 14) Peptide sequence (ARTKQTAR[Ac-K]STGG[Ac-K]APRKQLAGGKKC) is derived from human histone H3 (1-21) and is suitable for use as the assay control of histone (de-)methylation and (de-)...
Acetylated Histone H4 Peptide I Acetylated Histone H4 Peptide I

Acetylated Histone H4 Peptide I

Reference: H13-358-500
€0.00 (tax incl.)
The Acetylated Histone H4 (K5, 8, 12, 16) Peptide sequence (SGRG[Ac-K]GG[Ac-K]GLG[Ac-K]GGA[Ac-K]RHRKVGGKKC) is derived from human histone H4 (1-21) and is suitable for use as the assay control of histone...
AMARA Peptide AMARA Peptide

AMARA Peptide

Reference: A11-58
€0.00 (tax incl.)
The AMARA substrate peptide sequence (AMARAASAAALARRR) is routinely evaluated as a substrate for SIK and AMPK.
Autocamtide 2 Autocamtide 2

Autocamtide 2

Reference: A15-58
€0.00 (tax incl.)
The Autocamtide 2 peptide sequence (KKALRRQETVDAL-amide) is based on the autophosphorylation site (amino acid 283-290) on CaMKII.
Axltide Axltide

Axltide

Reference: A16-58
€0.00 (tax incl.)
The Axltide peptide sequence (KKSRGDYMTMQIG) is based on the mouse Insulin receptor substrate 1 (amino acid 979-989).
CATCHtide CATCHtide

CATCHtide

Reference: C02-58
€0.00 (tax incl.)
The CATCHtide peptide sequence (CRRHYYYDTHTNTYY-LRTFGHNTRR) is derived from human SLC12A2 (amino acids 198-217) and is suitable as a substrate for kinases OSR1 and STK39.
CDKtide CDKtide

CDKtide

Reference: C06-58
€0.00 (tax incl.)
The CDKtide peptide sequence (CKKKYSPTSPSYSPTSPSY-SPTSPS) is derived from the C-terminus of the largest subunit of human RNA polymerase II which has 52 approximate tandem repeats of 7 amino acids...
Chktide Chktide

Chktide

Reference: C10-58
€0.00 (tax incl.)
The Chktide peptide sequence (KKKVSRSGLYRSPSMPENLNRPR) is based on the human CDC25C protein isoform A (amino acid 205-225).
CK1tide CK1tide

CK1tide

Reference: C07-58-1
€0.00 (tax incl.)
The CK1tide synthetic peptide [HAAIGDDDDAYSITA-NH2] is routinely evaluated as a substrate for CK1 family kinases, such as CK1 and CK1 delta.
CREBtide CREBtide

CREBtide

Reference: C50-58
€0.00 (tax incl.)
The CREBtide peptide sequence (KRREILSRRPSYR) is based on the human CREB1 isoform A (amino acid 109-121).
Crosstide Crosstide

Crosstide

Reference: C51-58
€0.00 (tax incl.)
The Crosstide peptide sequence (GRPRTSSFAEG) is based on the GSK3.
CSKtide CSKtide

CSKtide

Reference: C63-58
€0.00 (tax incl.)
The synthetic peptide CSKtide (KKKEEIYFFFG-NH2) contains a tyrosine protein kinase phosphorylation site and can be used for CSK and TNK1 assay.
DYRKtide DYRKtide

DYRKtide

Reference: D96-58
€0.00 (tax incl.)
The synthetic peptide (RRRFRPASPLRGPPK) contains a serine/threonine protein kinase phosphorylation site and is routinely evaluated as a substrate for DYRK family kinases.
EF2tide EF2tide

EF2tide

Reference: E01-58
€0.00 (tax incl.)
The EF2tide substrate peptide sequence (RKKFGESEKTKTKEFL) is based on dictyostelium myosin II heavy chain (amino acid 2020-2035).
EIF2S Peptide EIF2S Peptide

EIF2S Peptide

Reference: E23-58
€0.00 (tax incl.)
The 13 amino acids of EIF2S peptide sequence (CILLSELSRRRIR) is derived from human protein EIF2S1 between residues 46-57. This peptide is suitable for use as a substrate for MNK1 and EIF2AK family kinases.
GRKtide GRKtide

GRKtide

Reference: G46-58
€0.00 (tax incl.)
The synthetic peptide sequence (CRRREEEEESAAA) is routinely evaluated as a substrate for GRK family kinases, including GRK2, GRK3, GRK4 and GRK7.
GS Peptide GS Peptide

GS Peptide

Reference: G60-58
€0.00 (tax incl.)
The GS peptide sequence (PLSRTLSVSS) is derived from an N-terminus of glycogen synthase and is suitable for use as the substrate for DCAMKL1 and CAMKII family.
Histone H1 Peptide Histone H1 Peptide

Histone H1 Peptide

Reference: H10-58-1
€0.00 (tax incl.)
The Histone H1 Peptide (152-159) sequence (GGGPATP-KKAKKL-COOH) is derived from human histone H1 between amino acids 152-159 and is suitable for use as the substrate for CDK family kinase assays, such as CDK1, CDK2,...
Histone H3 Peptide (1-21) Histone H3 Peptide (1-21)

Histone H3 Peptide (1-21)

Reference: H12-58-500
€0.00 (tax incl.)
The Histone H3 Peptide (1-21) sequence (ARTKQTARKS-TGGKAPRKQLAGGKKC) is derived from human histone H3 (1-21) and is suitable for use as the substrate for histone methyltransferase (at K4 and K9) and acetyltransferase...
Histone H3 Peptide (1-21) Histone H3 Peptide (1-21)

Histone H3 Peptide (1-21)

Reference: H12-58-01
€0.00 (tax incl.)
The Histone H3 Peptide (1-21) sequence (ARTKQTARKS-TGGKAPRKQLAGGKKC) is derived from human histone H3 (1-21) and is suitable for use as the substrate for histone methyltransferase (at K4 and K9) and acetyltransferase...
Histone H4 Peptide (1-21) Histone H4 Peptide (1-21)

Histone H4 Peptide (1-21)

Reference: H13-58-500
€0.00 (tax incl.)
The Histone H4 Peptide (1-21) sequence (SGRGKGGKGL-GKGGAKRHRKVGGKKC) is derived from human histone H4 (1-21) and is suitable for use as the substrate for histone methyltransferase (at R3) and acetyltransferase (at K5,...
Histone H4 Peptide (1-21) Histone H4 Peptide (1-21)

Histone H4 Peptide (1-21)

Reference: H13-58-01
€0.00 (tax incl.)
The Histone H4 Peptide (1-21) sequence (SGRGKGGKGL-GKGGAKRHRKVGGKKC) is derived from human histone H4 (1-21) and is suitable for use as the substrate for histone methyltransferase (at R3) and acetyltransferase (at K5,...
HSP27tide HSP27tide

HSP27tide

Reference: H31-58
€0.00 (tax incl.)
The HSP27tide peptide sequence (RRLNRQLSVA-amide) is based on the mouse HSP27 (amino acid 80-85).
IGF1Rtide IGF1Rtide

IGF1Rtide

Reference: I15-58
€0.00 (tax incl.)
The 14 amino acids of IGF1Rtide peptide sequence (KKKSPGEYVNIEFG) is derived from human IRS-1 protein residues 891-902.
IKKtide IKKtide

IKKtide

Reference: I33-58
€0.00 (tax incl.)
The IKKtide peptide sequence (KKKKERLLDDRHDSG-LDSMKDEE) is derived from human IkBA (amino acids 21-41) and is suitable as a substrate for IKK alpha and IKK beta.
IRS1 (Y608) Peptide IRS1 (Y608) Peptide

IRS1 (Y608) Peptide

Reference: I40-58-1000
€0.00 (tax incl.)
The synthetic IRS1 (Y608) Peptide [KKHTDDGYMPMSPGVA] is derived from mouse insulin receptor substrate 1 (amino acids 603-616) and is suitable as substrate for JAK1 and JAK2.
JAK3tide JAK3tide

JAK3tide

Reference: J03-58-1000
€0.00 (tax incl.)
The JAK3tide synthetic peptide [GGEEEEYFELVKKKK] is routinely evaluated as a substrate for JAK3 and JAK2.
LKBtide LKBtide

LKBtide

Reference: L15-58
€0.00 (tax incl.)
The synthetic peptide LKBtide (LSNLYHQGKFLQTFCGSPLY-RRRC) is derived from human NUAK2 (amino acid 196-215) and can be phosphorylated by protein Serine/Threonine kinase 11 (STK11), also known as LKB1.
LRRKtide LRRKtide

LRRKtide

Reference: L10-58
€0.00 (tax incl.)
The LRRKtide peptide sequence (RLGRDKYKTLRQIRQ) is derived from human ezrin (amino acids 561-573), moesin (amino acids 539-553) and radixin (amino acids 558-570) and is suitable for use as a substrate for LRRK kinases.
MARCKS Peptide MARCKS Peptide

MARCKS Peptide

Reference: M02-58
€0.00 (tax incl.)
The synthetic peptide (KKRFSFKKSFKL) is derived from amino acid residues 154 –165 of protein myristoylated alanine-rich C-kinase substrate (MARCKS). This peptide is suitable for use as a substrate for PKC alpha, PKC...
Micro2 Peptide Micro2 Peptide

Micro2 Peptide

Reference: M08-58-1000
€0.00 (tax incl.)
The Micro2 Peptide sequence (KEEQSQITSQVTGQIGWR) is derived from human AP-2 complex subunit mu isoform b (amino acids 143-160) and is suitable as a substrate for AAK1, BMP2K, and GAK kinase assay.
MLC Peptide MLC Peptide

MLC Peptide

Reference: M09-58
€0.00 (tax incl.)
The MLC Peptide sequence (AKRPQRATSNVFS) represents the phosphate-accepting domain of human MYL9 (amino acids 12-23) and can be used as a substrate for PHKG1, PHKG2 and DAPK2.
Modified EIF2S Peptide Modified EIF2S Peptide

Modified EIF2S Peptide

Reference: E23-58B
€0.00 (tax incl.)
The Modified EIF2S Peptide sequence (Modified-CILLSELSRRRIR) is derived from human EIF2S1 (46-57) and is suitable for use as the substrate for EIF2AK kinase family and MNK1.
Modified PLKtide Modified PLKtide

Modified PLKtide

Reference: P41-58B
€0.00 (tax incl.)
The Modified PLKtide peptide sequence (Modified-CKKLGEDQAEEISDDLLEDSLSDEDE) is derived from the CDC25C protein sequence (182-204).
Modified SGKtide Modified SGKtide

Modified SGKtide

Reference: S08-58B
€0.00 (tax incl.)
The Modified SGKtide peptide sequence (Modified- CKKRNRRLSVA) contains serine protein kinase phosphorylation site and is evaluated as a substrate for SGK and NDR family kinases.
MRCL3 Peptide MRCL3 Peptide

MRCL3 Peptide

Reference: M56-58
€0.00 (tax incl.)
The synthetic substrate MRCL3 Peptide (KKRPQRATSN-VFAM-NH2) is derived from human myosin regulatory light chain MRCL3 (amino acid 11-24) and can be used for MLCK, MYLK2 and MYLK3 kinase assay.

Menu

Settings

Please sign in first.

Sign in