Research kits (18)

CheKine™ Catalase (CAT) Activity Assay Kit

Reference: KTB1040_96T

€0.00 (tax incl.)

CheKine™ Catalase Activity Assay Kit provides a simple and easy colorimetric assay for the study of catalase activity in a variety of biological samples such as cell and tissue lysates or biological fluids. This assay...

p38 Substrate

Reference: P03-58

€0.00 (tax incl.)

The synthetic peptide (IPTTPITTTYFFFKKK) contains serine/threonine protein kinase phosphorylation sites and is routinely evaluated as a substrate for p38 family kinases.

CheKine™ Catalase (CAT) Activity Assay Kit

Reference: KTB1040_480T

€0.00 (tax incl.)

CheKine™ Catalase Activity Assay Kit provides a simple and easy colorimetric assay for the study of catalase activity in a variety of biological samples such as cell and tissue lysates or biological fluids. This assay...

PKA Substrate

Reference: C01-58

€0.00 (tax incl.)

The PKA sub peptide sequence (CGRTGRRNSI-amide) is based on the cAMP-dependent protein kinase inhibitor alpha (amino acid 15-23).

CheKine™ Lipid Peroxidation (MDA) Assay kit

Reference: KTB1050_48T

€0.00 (tax incl.)

CheKine™ Lipid Peroxidation (MDA) Assay Kit provides a convenient tool for detection of the malondialdehyde (MDA) present in a variety of samples. MDA, together with 4-hydroxynonenal (4-HNE), is a natural bi-product...

PLpro FRET Substrate

Reference: PL01-58-500

€0.00 (tax incl.)

Synthetic FRET peptide substrate specific for PLpro.

CheKine™ Lipid Peroxidation (MDA) Assay kit

Reference: KTB1050_96T

€0.00 (tax incl.)

CheKine™ Lipid Peroxidation (MDA) Assay Kit provides a convenient tool for detection of the malondialdehyde (MDA) present in a variety of samples. MDA, together with 4-hydroxynonenal (4-HNE), is a natural bi-product...

PLpro FRET Substrate

Reference: PL01-58-1000

€0.00 (tax incl.)

Synthetic FRET peptide substrate specific for PLpro.

CheKine™ Xanthine Oxidase Assay Kit

Reference: KTB1070_48T

€0.00 (tax incl.)

CheKine™ Xanthine Oxidase Assay Kit provides a simple and easy colorimetric assay for the quantitative determination of the XO present in a variety of samples. In the assay, XO oxidizes xanthine to superoxide (O2-)....

PP1/PP2A Substrate

Reference: P50-58-1000

€0.00 (tax incl.)

The PP1/PP2A Substrate peptide [GRPRTS(p)SFAEG] is derived from human GSK3b (glycogen synthase kinase-3 beta) (amino acids 3-13) and is suitable as PP1 and PP2A substrate.

CheKine™ Xanthine Oxidase Assay Kit

Reference: KTB1070_96T

€0.00 (tax incl.)

CheKine™ Xanthine Oxidase Assay Kit provides a simple and easy colorimetric assay for the quantitative determination of the XO present in a variety of samples. In the assay, XO oxidizes xanthine to superoxide (O2-)....

PP2B Substrate

Reference: P51-58-1000

€0.00 (tax incl.)

The PP2B Substrate peptide [DLDVPIPGRFDRRV(p)SVAAE] is derived from bovine PRKAR2A (cAMP-dependent protein kinase type II-alpha regulatory subunit) (amino acids 82-100) and is suitable as PP2B substrate.

CheKine™ Xanthine Oxidase Assay Kit

Reference: KTB1070_480T

€0.00 (tax incl.)

CheKine™ Xanthine Oxidase Assay Kit provides a simple and easy colorimetric assay for the quantitative determination of the XO present in a variety of samples. In the assay, XO oxidizes xanthine to superoxide (O2-)....

RSK Substrate

Reference: S06-58

€0.00 (tax incl.)

The RSK sub peptide sequence (KRRRLSSLRA) is based on human 40S ribosomal protein S6 (amino acid 230-239).

CheKine™ Superoxide anion Scavenging Capacity Assay Kit

Reference: KTB1080_48T

€0.00 (tax incl.)

CheKine™ Superoxide anion Scavenging Assay Kit provides a simple and easy colorimetric assay for the study of Superoxide anion Scavenging ability in tissue/cell lysates and other biological fluids. In this assay,...

S6K Substrate

Reference: S05-58

€0.00 (tax incl.)

The S6K sub peptide sequence (KRRRLASLR) is based on human 40S ribosomal protein S6 (amino acid 230-238).

CheKine™ Superoxide anion Scavenging Capacity Assay Kit

Reference: KTB1080_96T

€0.00 (tax incl.)

CheKine™ Superoxide anion Scavenging Assay Kit provides a simple and easy colorimetric assay for the study of Superoxide anion Scavenging ability in tissue/cell lysates and other biological fluids. In this assay,...

SRC Substrate

Reference: S30-58

€0.00 (tax incl.)

The SRC sub peptide sequence (KVEKIGEGTYGVVYK-amide) is based on the p34cdc2 (amino acid 6-20).

CheKine™ Hydroxyl Free Radical Scavenging Capacity Assay Kit

Reference: KTB1090_48T

€0.00 (tax incl.)

CheKine™ Hydroxyl Free Radical Scavenging Capacity Assay Kit provides a simple and easy colorimetric assay for the study of Hydroxyl radical scavenging Capacity in various sample. In this assay, H2O2/ Fe2+ produces...

Tyrosine Kinase Substrate-3

Reference: T71-58

€0.00 (tax incl.)

The synthetic peptide Tyrosine Kinase Substrate-3 (RRLIEDAEYAARG) is derived from human SRC (amino acid 412-422) and considered to be a generic substrate for various protein tyrosine kinases.

CheKine™ Hydroxyl Free Radical Scavenging Capacity Assay Kit

Reference: KTB1090_96T

€0.00 (tax incl.)

CheKine™ Hydroxyl Free Radical Scavenging Capacity Assay Kit provides a simple and easy colorimetric assay for the study of Hydroxyl radical scavenging Capacity in various sample. In this assay, H2O2/ Fe2+ produces...

DUB Substrate I

Reference: U06-57-10

€0.00 (tax incl.)

The ubiquitin-based proluciferin substrate is based on the C-terminal derivative of Ubiquitin.

CheKine™ Lactate Assay Kit

Reference: KTB1100_48T

€0.00 (tax incl.)

CheKine™ Lactate Assay Kit provides a convenient means for detecting L (+) -Lactate in biological samples such as in serum or plasma, cells, culture and fermentation media. In this kit lactate is oxidized by lactate...

DUB Substrate II

Reference: S293-57-10

€0.00 (tax incl.)

The SUMO1-based proluciferin substrate is based on the C-terminal derivative of SUMO1.

CheKine™ Lactate Assay Kit

Reference: KTB1100_96T

€0.00 (tax incl.)

CheKine™ Lactate Assay Kit provides a convenient means for detecting L (+) -Lactate in biological samples such as in serum or plasma, cells, culture and fermentation media. In this kit lactate is oxidized by lactate...

DUB Substrate III

Reference: N263-57-10

€0.00 (tax incl.)

The NEDD8-based proluciferin substrate is based on the C-terminal derivative of NEDD8.

CheKine™ Lactate Assay Kit

Reference: KTB1100_480T

€0.00 (tax incl.)

CheKine™ Lactate Assay Kit provides a convenient means for detecting L (+) -Lactate in biological samples such as in serum or plasma, cells, culture and fermentation media. In this kit lactate is oxidized by lactate...

DNMT Substrate-1

Reference: D53-58-05

€0.00 (tax incl.)

The synthetic double-stranded oligonucleotide (Sense: 5’- GATCCGACGACGACGCGCGCGCGACGACGAGATC; Anti-sense: 5’- GATCTCGTCGTCGCGCGCGCGTCGTCGTCGGAC) is used as a substrate for DNA methyltransferase 3A (DNMT3A).

CheKine™ Lactate Dehydrogenase (LDH) Assay Kit

Reference: KTB1110_48T

€0.00 (tax incl.)

CheKine™ Lactate Dehydrogenase Assay Kit provides a simple and easy colorimetric assay for measuring Lactate Dehydrogenase in serum, plasma, cell culture supernatants, tissue/cell lysates culture medium, fermentation...

METTL3/METTL14 Substrate

Reference: M323-58-025

€0.00 (tax incl.)

The synthetic single-stranded 27 base’s oligo ribo-nucleotide is used as a substrate for assay of methyltransferase METTL3/METTL14 complex.

CheKine™ Lactate Dehydrogenase (LDH) Assay Kit

Reference: KTB1110_96T

€0.00 (tax incl.)

CheKine™ Lactate Dehydrogenase Assay Kit provides a simple and easy colorimetric assay for measuring Lactate Dehydrogenase in serum, plasma, cell culture supernatants, tissue/cell lysates culture medium, fermentation...

Poly (1:1 dI, dC) Acid

Reference: P62-58-25

€0.00 (tax incl.)

The synthetic poly (deoxyinosinic-deoxycytidylic) acid sodium salt – double-stranded polymer (synthesized as 1:1 ratio) is used as a substrate for DNA methyltransferases.

CheKine™ Lactate Dehydrogenase (LDH) Assay Kit

Reference: KTB1110_480T

€0.00 (tax incl.)

CheKine™ Lactate Dehydrogenase Assay Kit provides a simple and easy colorimetric assay for measuring Lactate Dehydrogenase in serum, plasma, cell culture supernatants, tissue/cell lysates culture medium, fermentation...

DLG (Dilauroyl-sn-glycerol)

Reference: D430-59-200

€0.00 (tax incl.)

The substrate solution used for assaying Diacylglycerol kinases.

CheKine™ Glucose Assay Kit

Reference: KTB1300_48T

€0.00 (tax incl.)

CheKine™ Glucose Assay Kit provides simple, direct measurement of glucose concentrations in various biological samples, including serum, plasma, urine, other body fluid, food, growth medium, etc. In this kit, the...

DLG (Dilauroyl-sn-glycerol)

Reference: D430-59-500

€0.00 (tax incl.)

The substrate solution used for assaying Diacylglycerol kinases.

CheKine™ Glucose Assay Kit

Reference: KTB1300_96T

€0.00 (tax incl.)

CheKine™ Glucose Assay Kit provides simple, direct measurement of glucose concentrations in various biological samples, including serum, plasma, urine, other body fluid, food, growth medium, etc. In this kit, the...

PI (Phosphatidylinositol)

Reference: P420-59-500

€0.00 (tax incl.)

The substrate solution used for assaying lipid kinases.

CheKine™ Glucose Assay Kit

Reference: KTB1300_192T

€0.00 (tax incl.)

CheKine™ Glucose Assay Kit provides simple, direct measurement of glucose concentrations in various biological samples, including serum, plasma, urine, other body fluid, food, growth medium, etc. In this kit, the...

PI (Phosphatidylinositol)

Reference: P420-59-1000

€0.00 (tax incl.)

The substrate solution used for assaying lipid kinases.

CheKine™ Glucose Oxidase Activity (GOD) Assay Kit

Reference: KTB1310_48T

€0.00 (tax incl.)

CheKine™ Glucose Oxidase Activity Assay Kit provides a simple and easy colorimetric assay for detecting Glucose Oxidase Activity in biological samples such as in serum or plasma, cells, urine, other body fluid, food,...

PI(3)P

Reference: P421-59-05

€0.00 (tax incl.)

The substrate solution used for assaying lipid kinases.

CheKine™ Glucose Oxidase Activity (GOD) Assay Kit

Reference: KTB1310_96T

€0.00 (tax incl.)

CheKine™ Glucose Oxidase Activity Assay Kit provides a simple and easy colorimetric assay for detecting Glucose Oxidase Activity in biological samples such as in serum or plasma, cells, urine, other body fluid, food,...

PI(3)P

Reference: P421-59-1000

€0.00 (tax incl.)

The substrate solution used for assaying lipid kinases.

CheKine™ Glucose Oxidase Activity (GOD) Assay Kit

Reference: KTB1310_480T

€0.00 (tax incl.)

CheKine™ Glucose Oxidase Activity Assay Kit provides a simple and easy colorimetric assay for detecting Glucose Oxidase Activity in biological samples such as in serum or plasma, cells, urine, other body fluid, food,...

PI(3)P:PS

Reference: P426-59-500

€0.00 (tax incl.)

The substrate solution used for assaying lipid kinases.

CheKine™ Hydrogen Peroxide (H2O2) Assay Kit

Reference: KTB1041_48T

€0.00 (tax incl.)

CheKine™ Hydrogen Peroxide Assay Kit provides a simple and easy colorimetric assay for measuring hydrogen peroxide in serum, plasma, cell culture supernatants, tissue/cell lysates and other biological fluids. In the...

PI(3)P:PS

Reference: P426-59-1000

€0.00 (tax incl.)

The substrate solution used for assaying lipid kinases.

CheKine™ Hydrogen Peroxide (H2O2) Assay Kit

Reference: KTB1041_96T

€0.00 (tax incl.)

CheKine™ Hydrogen Peroxide Assay Kit provides a simple and easy colorimetric assay for measuring hydrogen peroxide in serum, plasma, cell culture supernatants, tissue/cell lysates and other biological fluids. In the...

PI(4)P

Reference: P422-59-500

€0.00 (tax incl.)

The substrate solution used for assaying lipid kinases.

CheKine™ Hydrogen Peroxide (H2O2) Assay Kit

Reference: KTB1041_480T

€0.00 (tax incl.)

CheKine™ Hydrogen Peroxide Assay Kit provides a simple and easy colorimetric assay for measuring hydrogen peroxide in serum, plasma, cell culture supernatants, tissue/cell lysates and other biological fluids. In the...

PI(4)P

Reference: P422-59-1000

€0.00 (tax incl.)

The substrate solution used for assaying lipid kinases.

CheKine™ Nitric Oxide (NO) Assay Kit

Reference: KTB1400_48T

€0.00 (tax incl.)

CheKine™ Nitric Oxide Assay Kit is designed to accurately measure NO production following reduction of nitrate to nitrite by using improved Griess method. The Griess assay’s mechanism is summarized as the azo coupling...

PI(4)P:PS

Reference: P427-59-500

€0.00 (tax incl.)

The substrate solution used for assaying lipid kinases.

CheKine™ Nitric Oxide (NO) Assay Kit

Reference: KTB1400_96T

€0.00 (tax incl.)

CheKine™ Nitric Oxide Assay Kit is designed to accurately measure NO production following reduction of nitrate to nitrite by using improved Griess method. The Griess assay’s mechanism is summarized as the azo coupling...

PI(4)P:PS

Reference: P427-59-1000

€0.00 (tax incl.)

The substrate solution used for assaying lipid kinases.

CheKine™ Nitric Oxide (NO) Assay Kit

Reference: KTB1400_192T

€0.00 (tax incl.)

CheKine™ Nitric Oxide Assay Kit is designed to accurately measure NO production following reduction of nitrate to nitrite by using improved Griess method. The Griess assay’s mechanism is summarized as the azo coupling...

PI(4,5)P2

Reference: P424-59-500

€0.00 (tax incl.)

The substrate solution used for assaying lipid kinases.

CheKine™ Total Antioxidant Capacity (TAC) Assay Kit

Reference: KTB1500_48T

€0.00 (tax incl.)

CheKine™ Total Antioxidant Capacity (TAC) Assay Kit provides a simple and easy colorimetric assay for measuring Total Antioxidant Capacity in serum, plasma, cell culture supernatants, urine, tissue/ cell lysates and...

PI(4,5)P2

Reference: P424-59-1000

€0.00 (tax incl.)

The substrate solution used for assaying lipid kinases.

CheKine™ Total Antioxidant Capacity (TAC) Assay Kit

Reference: KTB1500_96T

€0.00 (tax incl.)

CheKine™ Total Antioxidant Capacity (TAC) Assay Kit provides a simple and easy colorimetric assay for measuring Total Antioxidant Capacity in serum, plasma, cell culture supernatants, urine, tissue/ cell lysates and...

PI(4,5)P2:PS

Reference: P429-59-500

€0.00 (tax incl.)

The substrate solution used for assaying lipid kinases.

CheKine™ Total Antioxidant Capacity (TAC) Assay Kit

Reference: KTB1500_480T

€0.00 (tax incl.)

CheKine™ Total Antioxidant Capacity (TAC) Assay Kit provides a simple and easy colorimetric assay for measuring Total Antioxidant Capacity in serum, plasma, cell culture supernatants, urine, tissue/ cell lysates and...

PI(4,5)P2:PS

Reference: P429-59-1000

€0.00 (tax incl.)

The substrate solution used for assaying lipid kinases.

CheKine™ Reduced Glutathione (GSH) Colorimetric Assay Kit

Reference: KTB1600_48T

€0.00 (tax incl.)

DTNB reacts with reduced glutathione to form a yellow product. The optical density measured at 412 nm, can directly reflect glutathione concentration in the sample.

PI(5)P

Reference: P423-59-500

€0.00 (tax incl.)

The substrate solution used for assaying lipid kinases.

CheKine™ Reduced Glutathione (GSH) Colorimetric Assay Kit

Reference: KTB1600_96T

€0.00 (tax incl.)

DTNB reacts with reduced glutathione to form a yellow product. The optical density measured at 412 nm, can directly reflect glutathione concentration in the sample.

PI(5)P

Reference: P423-59-1000

€0.00 (tax incl.)

The substrate solution used for assaying lipid kinases.

CheKine™ Glutathione Oxidized (GSSG) Colorimetric Assay Kit

Reference: KTB1610_48T

€0.00 (tax incl.)

Reduced glutathione can react with DTNB and generate 2-nitro-5-mercaptobenzoic acid, which has the maximum light absorption at 412 nm wavelength. The original reduced glutathione in the sample is inhibited by...

PI(5)P:PS

Reference: P428-59-500

€0.00 (tax incl.)

The substrate solution used for assaying lipid kinases.

CheKine™ Glutathione Oxidized (GSSG) Colorimetric Assay Kit

Reference: KTB1610_96T

€0.00 (tax incl.)

Reduced glutathione can react with DTNB and generate 2-nitro-5-mercaptobenzoic acid, which has the maximum light absorption at 412 nm wavelength. The original reduced glutathione in the sample is inhibited by...

PI(5)P:PS

Reference: P428-59-1000

€0.00 (tax incl.)

The substrate solution used for assaying lipid kinases.

CheKine™ Glutathione Oxidized (GSSG) Colorimetric Assay Kit

Reference: KTB1610_96T*5

€0.00 (tax incl.)

Reduced glutathione can react with DTNB and generate 2-nitro-5-mercaptobenzoic acid, which has the maximum light absorption at 412 nm wavelength. The original reduced glutathione in the sample is inhibited by...

PI:PS

Reference: P425-59B-500

€0.00 (tax incl.)

The substrate solution used for assaying lipid kinases.

CheKine™ Glutathione Reductases (GR) Colorimetric Assay Kit

Reference: KTB1620_48T

€0.00 (tax incl.)

GR can catalyze the reduction of NADPH to GSSG to regenerate GSH, and NADPH dehydrogenates to produce NADP +; NADPH has a characteristic absorption peak at 340 nm, while NADP + has no absorption peak at this...

PI:PS

Reference: P425-59B-1000

€0.00 (tax incl.)

The substrate solution used for assaying lipid kinases.

CheKine™ Glutathione Reductases (GR) Colorimetric Assay Kit

Reference: KTB1620_96T

€0.00 (tax incl.)

GR can catalyze the reduction of NADPH to GSSG to regenerate GSH, and NADPH dehydrogenates to produce NADP +; NADPH has a characteristic absorption peak at 340 nm, while NADP + has no absorption peak at this...

D-Fructose-6-phosphate

Reference: F520-59-10

€0.00 (tax incl.)

D-Fructose-6-phosphate (sodium salt hydrate) is supplied as a crystalline solid.

CheKine™ Glutathione Reductases (GR) Colorimetric Assay Kit

Reference: KTB1620_192T

€0.00 (tax incl.)

GR can catalyze the reduction of NADPH to GSSG to regenerate GSH, and NADPH dehydrogenates to produce NADP +; NADPH has a characteristic absorption peak at 340 nm, while NADP + has no absorption peak at this...

D-Glucose-6-phosphate

Reference: F521-59-10 mg

€0.00 (tax incl.)

D-glucose-6-phosphate (sodium salt) is supplied as a crystalline solid.

CheKine™ Glutathione S-Transferase (GST) Colorimetric Assay Kit

Reference: KTB1630_48T

€0.00 (tax incl.)

GST catalyzes the binding of GSH to CDNB. The conjugation is accompanied by an increase in absorbance at 340 nm. The rate of increase is directly proportional to the GST activity in the sample.

CheKine™ Glutathione S-Transferase (GST) Colorimetric Assay Kit

Reference: KTB1630_96T

€0.00 (tax incl.)

GST catalyzes the binding of GSH to CDNB. The conjugation is accompanied by an increase in absorbance at 340 nm. The rate of increase is directly proportional to the GST activity in the sample.

CheKine™ Glutathione Peroxidase (GSH-Px) Colorimetric Assay Kit

Reference: KTB1640_48T

€0.00 (tax incl.)

GSH-Px catalyzes H2O2 to oxidize GSH to produce GSSG; glutathione reductase (GR) catalyzes NADPH to reduce GSSG to regenerate GSH, while NADPH oxidizes to produce NADP+; NADPH has a characteristic absorption peak at...

CheKine™ Glutathione Peroxidase (GSH-Px) Colorimetric Assay Kit

Reference: KTB1640_96T

€0.00 (tax incl.)

GSH-Px catalyzes H2O2 to oxidize GSH to produce GSSG; glutathione reductase (GR) catalyzes NADPH to reduce GSSG to regenerate GSH, while NADPH oxidizes to produce NADP+; NADPH has a characteristic absorption peak at...

CheKine™ Glutathione Peroxidase (GSH-Px) Colorimetric Assay Kit

Reference: KTB1640_192T

€0.00 (tax incl.)

GSH-Px catalyzes H2O2 to oxidize GSH to produce GSSG; glutathione reductase (GR) catalyzes NADPH to reduce GSSG to regenerate GSH, while NADPH oxidizes to produce NADP+; NADPH has a characteristic absorption peak at...

CheKine™ Thioredoxin Reductase (TrxR) Colorimetric Assay Kit

Reference: KTB1650_48T

€0.00 (tax incl.)

TrxR can catalyzes the reduction of DTNB by NADPH to generate TNB and NADP+. TNB has a characteristic absorption peak at 412 nm. TrxR activity can be calculated by measuring the increase rate of TNB at 412 nm.

CheKine™ Thioredoxin Reductase (TrxR) Colorimetric Assay Kit

Reference: KTB1650_96T

€0.00 (tax incl.)

TrxR can catalyzes the reduction of DTNB by NADPH to generate TNB and NADP+. TNB has a characteristic absorption peak at 412 nm. TrxR activity can be calculated by measuring the increase rate of TNB at 412 nm.

CheKine™ Thioredoxin Peroxidase (TPX) Colorimetric Assay Kit

Reference: KTB1660_48T

€0.00 (tax incl.)

TPX catalyzes H2O2 to oxidize dithiothreitol (DTT). The absorption wavelength of H2O2 is 240nm. TPX activity can be calculated by measuring the decrease rate of absorbance at 240nm and subtracting H2O2 catalyzed by...

CheKine™ Thioredoxin Peroxidase (TPX) Colorimetric Assay Kit

Reference: KTB1660_96T

€0.00 (tax incl.)

TPX catalyzes H2O2 to oxidize dithiothreitol (DTT). The absorption wavelength of H2O2 is 240nm. TPX activity can be calculated by measuring the decrease rate of absorbance at 240nm and subtracting H2O2 catalyzed by...

CheKine™ NADH Oxidase (NOX) Colorimetric Assay Kit

Reference: KTB1021_48T

€0.00 (tax incl.)

NOX can oxidize NADH to NAD, the oxidation of NADH is coupled with the reduction of 2,6 dichlorophenol indigo (DCPIP), the blue DCPIP is reduced to colorless DCPIP, and the reduction rate of blue DCPIP is measured at...

CheKine™ NADH Oxidase (NOX) Colorimetric Assay Kit

Reference: KTB1021_96T

€0.00 (tax incl.)

NOX can oxidize NADH to NAD, the oxidation of NADH is coupled with the reduction of 2,6 dichlorophenol indigo (DCPIP), the blue DCPIP is reduced to colorless DCPIP, and the reduction rate of blue DCPIP is measured at...

CheKine™ Pyruvate Kinase (PK) Colorimetric Assay Kit

Reference: KTB1120_48T

€0.00 (tax incl.)

PK catalyzes phosphoenolpyruvate and ADP reaction into ATP and pyruvate, and lactate dehydrogenase further catalyzes the production of lactic acid and NAD + by NADH and pyruvate. The rate of NADH decline at 340 nm can...

CheKine™ Pyruvate Kinase (PK) Colorimetric Assay Kit

Reference: KTB1120_96T

€0.00 (tax incl.)

PK catalyzes phosphoenolpyruvate and ADP reaction into ATP and pyruvate, and lactate dehydrogenase further catalyzes the production of lactic acid and NAD + by NADH and pyruvate. The rate of NADH decline at 340 nm can...

CheKine™ Protein Carbonyl Colorimetric Assay Kit

Reference: KTB1200_48T

€0.00 (tax incl.)

The carbonyl group reacts with 2,4-dinitrophenylhydrazine to produce red 2,4-dinitrophenylhydrazone with a characteristic absorption peak at 370 nm.

CheKine™ Protein Carbonyl Colorimetric Assay Kit

Reference: KTB1200_96T

€0.00 (tax incl.)

The carbonyl group reacts with 2,4-dinitrophenylhydrazine to produce red 2,4-dinitrophenylhydrazone with a characteristic absorption peak at 370 nm.

CheKine™ Tissue and Blood Alkaline Phosphatase (AKP/ALP) Colorimetric Assay Kit

Reference: KTB1700_48T

€0.00 (tax incl.)

In an alkaline environment, AKP / ALP catalyzes phthalate disodium to generate free phenol; phenol reacts with 4-aminoantipyrine and potassium ferricyanide to produce a red quinone derivative, which has characteristic...

CheKine™ Tissue and Blood Alkaline Phosphatase (AKP/ALP) Colorimetric Assay Kit

Reference: KTB1700_96T

€0.00 (tax incl.)

In an alkaline environment, AKP / ALP catalyzes phthalate disodium to generate free phenol; phenol reacts with 4-aminoantipyrine and potassium ferricyanide to produce a red quinone derivative, which has characteristic...

CheKine™ Tissue and Blood Alkaline Phosphatase (AKP/ALP) Colorimetric Assay Kit

Reference: KTB1700_96T*5

€0.00 (tax incl.)

In an alkaline environment, AKP / ALP catalyzes phthalate disodium to generate free phenol; phenol reacts with 4-aminoantipyrine and potassium ferricyanide to produce a red quinone derivative, which has characteristic...

CheKine™ Na⁺/K⁺-ATPase Activity Colorimetric Assay Kit

Reference: KTB1800_48T

€0.00 (tax incl.)

The kit provides a simple method for detecting Na⁺/K⁺-ATPase activity in a variety of biological samples such as serum, plasma, tissues, cells, plants and bacteria. In the assay, Na⁺/K⁺-ATPase catalyzes ATP hydrolysis...

CheKine™ Na⁺/K⁺-ATPase Activity Colorimetric Assay Kit

Reference: KTB1800_96T

€0.00 (tax incl.)

The kit provides a simple method for detecting Na⁺/K⁺-ATPase activity in a variety of biological samples such as serum, plasma, tissues, cells, plants and bacteria. In the assay, Na⁺/K⁺-ATPase catalyzes ATP hydrolysis...

Category: Research kits

Menu

Settings