Genetics (3)

EpiMelt ALOX12 Non-Methylated assay specific control

Reference: EpiMeltALOX12_NM

€0.00 (tax incl.)

The EpiMelt ALOX12 kit contains non-methylated ready to use assay specific controls for 100 PCRs

Non-Targeting CRISPR control in pRSG21-U6-(sg)-CMV-GFP-Puro (virus)

Reference: SGCTL-NT-pRSG21-V

€0.00 (tax incl.)

sgNT (CTRL0003) gRNA Seq: 5'-GGCAGTCGTTCGGTTGATAT-3' (OK for Human and Mouse)

EpiMelt ALOX12 Methylated and Non-Methylated assay specific control Control set

Reference: EpiMeltALOX12_Both

€0.00 (tax incl.)

The EpiMelt ALOX12 kit contains a set of methylated and non - methylated ready to use assay specific controls for 100 PCRs

Non-Targeting CRISPR control in pRSGT16-U6Tet-(sg)-CMV-TetR-RFP-Puro (plasmid)

Reference: SGCTL-NT-pRSGT16

€0.00 (tax incl.)

sgNT (CTRL0003) gRNA Seq: 5'-GGCAGTCGTTCGGTTGATAT-3' (OK for Human and Mouse)

EpiMelt ALX1 Methylated assay specific control

Reference: EpiMeltALX1_M

€0.00 (tax incl.)

The EpiMelt ALX1 kit contains methylated ready to use assay specific controls for 100 PCRs

Non-Targeting CRISPR control in pRSGT16-U6Tet-(sg)-CMV-TetR-RFP-Puro (virus)

Reference: SGCTL-NT-pRSGT16-V

€0.00 (tax incl.)

sgNT (CTRL0003) gRNA Seq: 5'-GGCAGTCGTTCGGTTGATAT-3' (OK for Human and Mouse)

EpiMelt ALX1 Non-Methylated assay specific control

Reference: EpiMeltALX1_NM

€0.00 (tax incl.)

The EpiMelt ALX1 kit contains non-methylated ready to use assay specific controls for 100 PCRs

Non-Targeting CRISPR control in pRSGT17-U6Tet-(sg)-CMV-TetR-GFP-Puro Vector (plasmid)

Reference: SGCTL-NT-pRSGT17

€0.00 (tax incl.)

sgNT (CTRL0003) gRNA Seq: 5'-GGCAGTCGTTCGGTTGATAT-3' (OK for Human and Mouse)

EpiMelt ALX1 Methylated and Non-Methylated assay specific control Control set

Reference: EpiMeltALX1_Both

€0.00 (tax incl.)

The EpiMelt ALX1 kit contains a set of methylated and non - methylated ready to use assay specific controls for 100 PCRs

Non-Targeting CRISPR control in pRSGT17-U6Tet-(sg)-CMV-TetR-GFP-Puro (virus)

Reference: SGCTL-NT-pRSGT17-V

€0.00 (tax incl.)

sgNT (CTRL0003) gRNA Seq: 5'-GGCAGTCGTTCGGTTGATAT-3' (OK for Human and Mouse)

EpiMelt ALX3 Methylated assay specific control

Reference: EpiMeltALX3_M

€0.00 (tax incl.)

The EpiMelt ALX3 kit contains methylated ready to use assay specific controls for 100 PCRs

Non-Targeting Dual-sgRNA CRISPR control in pRSL10-mU6-sgNT1-hU6-sgNT2-UbiC-TagRFP-2A-puro (plasmid)

Reference: SGCTL-2NT-pRSL10

€0.00 (tax incl.)

EpiMelt ALX3 Non-Methylated assay specific control

Reference: EpiMeltALX3_NM

€0.00 (tax incl.)

The EpiMelt ALX3 kit contains non-methylated ready to use assay specific controls for 100 PCRs

Non-Targeting Dual-sgRNA CRISPR control in pRSL10-mU6-sgNT1-hU6-sgNT2-UbiC-TagRFP-2A-puro (virus)

Reference: SGCTL-2NT-pRSL10-V

€0.00 (tax incl.)

EpiMelt ALX3 Methylated and Non-Methylated assay specific control Control set

Reference: EpiMeltALX3_Both

€0.00 (tax incl.)

The EpiMelt ALX3 kit contains a set of methylated and non - methylated ready to use assay specific controls for 100 PCRs

shLuc Control (non-targeting) in pRSI16-U6-(sh)-UbiC-RFP-Puro (plasmid)

Reference: SHCTL-LUC-pRSI16

€0.00 (tax incl.)

EpiMelt ALX4 Methylated assay specific control

Reference: EpiMeltALX4_M

€0.00 (tax incl.)

The EpiMelt ALX4 kit contains methylated ready to use assay specific controls for 100 PCRs

shLuc Control (non-targeting) in pRSI16-U6-(sh)-UbiC-RFP-Puro (virus)

Reference: SHCTL-LUC-pRSI16-V

€0.00 (tax incl.)

EpiMelt ALX4 Non-Methylated assay specific control

Reference: EpiMeltALX4_NM

€0.00 (tax incl.)

The EpiMelt ALX4 kit contains non-methylated ready to use assay specific controls for 100 PCRs

shLuc Control (non-targeting) in pRSI17-U6-(sh)-UbiC-GFP-Puro (plasmid)

Reference: SHCTL-LUC-pRSI17

€0.00 (tax incl.)

EpiMelt ALX4 Methylated and Non-Methylated assay specific control Control set

Reference: EpiMeltALX4_Both

€0.00 (tax incl.)

The EpiMelt ALX4 kit contains a set of methylated and non - methylated ready to use assay specific controls for 100 PCRs

shLuc Control (non-targeting) in pRSI17-U6-(sh)-UbiC-GFP-Puro (virus)

Reference: SHCTL-LUC-pRSI17-V

€0.00 (tax incl.)

EpiMelt ANAPC5 Methylated assay specific control

Reference: EpiMeltANAPC5_M

€0.00 (tax incl.)

The EpiMelt ANAPC5 kit contains methylated ready to use assay specific controls for 100 PCRs

shLuc Control (non-targeting) in pRSIT16-U6Tet-(sh)-CMV-TetR-RFP-Puro (plasmid)

Reference: SHCTL-LUC-pRSIT16

€0.00 (tax incl.)

EpiMelt ANAPC5 Non-Methylated assay specific control

Reference: EpiMeltANAPC5_NM

€0.00 (tax incl.)

The EpiMelt ANAPC5 kit contains non-methylated ready to use assay specific controls for 100 PCRs

shLuc Control (non-targeting) in pRSIT16-U6Tet-(sh)-CMV-TetR-RFP-Puro (virus)

Reference: SHCTL-LUC-pRSIT16-V

€0.00 (tax incl.)

EpiMelt ANAPC5 Methylated and Non-Methylated assay specific control Control set

Reference: EpiMeltANAPC5_Both

€0.00 (tax incl.)

The EpiMelt ANAPC5 kit contains a set of methylated and non - methylated ready to use assay specific controls for 100 PCRs

shLuc Control (non-targeting) in pRSIT17-U6Tet-(sh)-CMV-TetR-GFP-Puro (plasmid)

Reference: SHCTL-LUC-pRSIT17

€0.00 (tax incl.)

EpiMelt APAF1 Methylated assay specific control

Reference: EpiMeltAPAF1_M

€0.00 (tax incl.)

The EpiMelt APAF1 kit contains methylated ready to use assay specific controls for 100 PCRs

shLuc Control (non-targeting) in pRSIT17-U6Tet-(sh)-CMV-TetR-GFP-Puro (virus)

Reference: SHCTL-LUC-pRSIT17-V

€0.00 (tax incl.)

EpiMelt APAF1 Non-Methylated assay specific control

Reference: EpiMeltAPAF1_NM

€0.00 (tax incl.)

The EpiMelt APAF1 kit contains non-methylated ready to use assay specific controls for 100 PCRs

shNT Control (non-targeting) in pRSI16-U6-(sh)-UbiC-RFP-Puro (plasmid)

Reference: SHCTL-NT-pRSI16

€0.00 (tax incl.)

shNT is OK for Human and Mouse

EpiMelt APAF1 Methylated and Non-Methylated assay specific control Control set

Reference: EpiMeltAPAF1_Both

€0.00 (tax incl.)

The EpiMelt APAF1 kit contains a set of methylated and non - methylated ready to use assay specific controls for 100 PCRs

shNT Control (non-targeting) in pRSI16-U6-(sh)-UbiC-RFP-Puro (virus)

Reference: SHCTL-NT-pRSI16-V

€0.00 (tax incl.)

shNT is OK for Human and Mouse

EpiMelt APBA1 Methylated assay specific control

Reference: EpiMeltAPBA1_M

€0.00 (tax incl.)

The EpiMelt APBA1 kit contains methylated ready to use assay specific controls for 100 PCRs

shNT Control (non-targeting) in pRSI17-U6-(sh)-UbiC-GFP-Puro (plasmid)

Reference: SHCTL-NT-pRSI17

€0.00 (tax incl.)

shNT is OK for Human and Mouse

EpiMelt APBA1 Non-Methylated assay specific control

Reference: EpiMeltAPBA1_NM

€0.00 (tax incl.)

The EpiMelt APBA1 kit contains non-methylated ready to use assay specific controls for 100 PCRs

shNT Control (non-targeting) in pRSI17-U6-(sh)-UbiC-GFP-Puro (virus)

Reference: SHCTL-NT-pRSI17-V

€0.00 (tax incl.)

shNT is OK for Human and Mouse

EpiMelt APBA1 Methylated and Non-Methylated assay specific control Control set

Reference: EpiMeltAPBA1_Both

€0.00 (tax incl.)

The EpiMelt APBA1 kit contains a set of methylated and non - methylated ready to use assay specific controls for 100 PCRs

shNT Control (non-targeting) in pRSIT16-U6Tet-(sh)-CMV-TetR-RFP-Puro (plasmid)

Reference: SHCTL-NT-pRSIT16

€0.00 (tax incl.)

shNT is OK for Human and Mouse

EpiMelt APC Methylated assay specific control

Reference: EpiMeltAPC_M

€0.00 (tax incl.)

The EpiMelt APC kit contains methylated ready to use assay specific controls for 100 PCRs

shNT Control (non-targeting) in pRSIT16-U6Tet-(sh)-CMV-TetR-RFP-Puro (virus)

Reference: SHCTL-NT-pRSIT16-V

€0.00 (tax incl.)

shNT is OK for Human and Mouse

EpiMelt APC Non-Methylated assay specific control

Reference: EpiMeltAPC_NM

€0.00 (tax incl.)

The EpiMelt APC kit contains non-methylated ready to use assay specific controls for 100 PCRs

shNT Control (non-targeting) in pRSIT17-U6Tet-(sh)-CMV-TetR-GFP-Puro (plasmid)

Reference: SHCTL-NT-pRSIT17

€0.00 (tax incl.)

shNT is OK for Human and Mouse

EpiMelt APC Methylated and Non-Methylated assay specific control Control set

Reference: EpiMeltAPC_Both

€0.00 (tax incl.)

The EpiMelt APC kit contains a set of methylated and non - methylated ready to use assay specific controls for 100 PCRs

shNT Control (non-targeting) in pRSIT17-U6Tet-(sh)-CMV-TetR-GFP-Puro (virus)

Reference: SHCTL-NT-pRSIT17-V

€0.00 (tax incl.)

shNT is OK for Human and Mouse

EpiMelt APEX1 Methylated assay specific control

Reference: EpiMeltAPEX1_M

€0.00 (tax incl.)

The EpiMelt APEX1 kit contains methylated ready to use assay specific controls for 100 PCRs

CRISPR Target for sgCopGFP Control (pRCdsGEB-CMV-dsCopGFP-EF1-Bleo, plasmid)

Reference: SVCOPG-P

€0.00 (tax incl.)

EpiMelt APEX1 Non-Methylated assay specific control

Reference: EpiMeltAPEX1_NM

€0.00 (tax incl.)

The EpiMelt APEX1 kit contains non-methylated ready to use assay specific controls for 100 PCRs

CRISPR Target for sgCopGFP Control (pRCdsGEB-CMV-dsCopGFP-EF1-Bleo, virus)

Reference: SVCOPG-V

€0.00 (tax incl.)

EpiMelt APEX1 Methylated and Non-Methylated assay specific control Control set

Reference: EpiMeltAPEX1_Both

€0.00 (tax incl.)

The EpiMelt APEX1 kit contains a set of methylated and non - methylated ready to use assay specific controls for 100 PCRs

Single Barcode-3' Construct in pScribe4-RFP-Puro, compatible with CloneTracker XP 1M/10M (plasmid)

Reference: BCXP3RP-P

€0.00 (tax incl.)

Barcode seq NOT in CloneTracker XP™ 1M/10M Lib (pScribe4/5/6)

EpiMelt APP Methylated assay specific control

Reference: EpiMeltAPP_M

€0.00 (tax incl.)

The EpiMelt APP kit contains methylated ready to use assay specific controls for 100 PCRs

Single Barcode-3' Construct in pScribe4-RFP-Puro, compatible with CloneTracker XP 1M/10M (virus)

Reference: BCXP3RP-V

€0.00 (tax incl.)

Barcode seq NOT in CloneTracker XP™ 1M/10M Lib (pScribe4/5/6)

EpiMelt APP Non-Methylated assay specific control

Reference: EpiMeltAPP_NM

€0.00 (tax incl.)

The EpiMelt APP kit contains non-methylated ready to use assay specific controls for 100 PCRs

Single Barcode-3' Construct in pScribe5-Venus-Puro, compatible with CloneTracker XP 1M/10M (plasmid)

Reference: BCXP3VP-P

€0.00 (tax incl.)

Barcode seq NOT in CloneTracker XP™ 1M/10M Lib (pScribe4/5/6)

EpiMelt APP Methylated and Non-Methylated assay specific control Control set

Reference: EpiMeltAPP_Both

€0.00 (tax incl.)

The EpiMelt APP kit contains a set of methylated and non - methylated ready to use assay specific controls for 100 PCRs

Single Barcode-3' Construct in pScribe5-Venus-Puro, compatible with CloneTracker XP 1M/10M (virus)

Reference: BCXP3VP-V

€0.00 (tax incl.)

Barcode seq NOT in CloneTracker XP™ 1M/10M Lib (pScribe4/5/6)

EpiMelt AR Methylated assay specific control

Reference: EpiMeltAR_M

€0.00 (tax incl.)

The EpiMelt AR kit contains methylated ready to use assay specific controls for 100 PCRs

Single Barcode-3' Construct in pScribe4M-RFP-Puro, compatible with CloneTracker XP 5M/50M (plasmid)

Reference: BCXP3RPM-P

€0.00 (tax incl.)

Barcode seq NOT in CloneTracker XP™ 5M/50M Lib (pScribe4M/5M/6M) - BC14(ACACCAGTTGTGCA)-21nt-BC30(TGCATGGTCAGTTGCATGGTCAACACGTCA)

EpiMelt AR Non-Methylated assay specific control

Reference: EpiMeltAR_NM

€0.00 (tax incl.)

The EpiMelt AR kit contains non-methylated ready to use assay specific controls for 100 PCRs

Single Barcode-3' Construct in pScribe4M-RFP-Puro, compatible with CloneTracker XP 5M/50M (virus)

Reference: BCXP3RPM-V

€0.00 (tax incl.)

Barcode seq NOT in CloneTracker XP™ 5M/50M Lib (pScribe4M/5M/6M) - BC14(ACACCAGTTGTGCA)-21nt-BC30(TGCATGGTCAGTTGCATGGTCAACACGTCA)

EpiMelt AR Methylated and Non-Methylated assay specific control Control set

Reference: EpiMeltAR_Both

€0.00 (tax incl.)

The EpiMelt AR kit contains a set of methylated and non - methylated ready to use assay specific controls for 100 PCRs

Single Barcode-3' Construct in pScribe4HM-RFP-Hygro, compatible with CloneTracker XP 5M/50M (plasmid)

Reference: BCXP3RHM-P

€0.00 (tax incl.)

Barcode sequence is NOT in CloneTracker XP™ 5M/50M Libraries (pScribe4M/5M/6M)) - BC14(ACACCAGTTGTGCA)-21nt-BC30(TGCATGGTCAGTTGCATGGTCAACACGTCA)

EpiMelt ARF4 Methylated assay specific control

Reference: EpiMeltARF4_M

€0.00 (tax incl.)

The EpiMelt ARF4 kit contains methylated ready to use assay specific controls for 100 PCRs

Single Barcode-3' Construct in pScribe4HM-RFP-Hygro, compatible with CloneTracker XP 5M/50M (virus)

Reference: BCXP3RHM-V

€0.00 (tax incl.)

Barcode seq NOT in CloneTracker XP™ 5M/50M Lib (pScribe4M/5M/6M) - BC14(ACACCAGTTGTGCA)-21nt-BC30(TGCATGGTCAGTTGCATGGTCAACACGTCA)

EpiMelt ARF4 Non-Methylated assay specific control

Reference: EpiMeltARF4_NM

€0.00 (tax incl.)

The EpiMelt ARF4 kit contains non-methylated ready to use assay specific controls for 100 PCRs

CRISPR Cas9 pRCCH-CMV-Cas9-2A-Hygro (plasmid)

Reference: SVC9-PS

€0.00 (tax incl.)

EpiMelt ARF4 Methylated and Non-Methylated assay specific control Control set

Reference: EpiMeltARF4_Both

€0.00 (tax incl.)

The EpiMelt ARF4 kit contains a set of methylated and non - methylated ready to use assay specific controls for 100 PCRs

CRISPR Cas9 pRCCH-CMV-Cas9-2A-Hygro (virus)

Reference: SVC9-VS

€0.00 (tax incl.)

EpiMelt ARHGAP29 Methylated assay specific control

Reference: EpiMeltARHGAP29_M

€0.00 (tax incl.)

The EpiMelt ARHGAP29 kit contains methylated ready to use assay specific controls for 100 PCRs

CRISPR Cas9 pRCCB-CMV-Cas9-2A-Blast (plasmid)

Reference: SVC9B-PS

€0.00 (tax incl.)

EpiMelt ARHGAP29 Non-Methylated assay specific control

Reference: EpiMeltARHGAP29_NM

€0.00 (tax incl.)

The EpiMelt ARHGAP29 kit contains non-methylated ready to use assay specific controls for 100 PCRs

CRISPR Cas9 pRCCB-CMV-Cas9-2A-Blast (virus)

Reference: SVC9B-VS

€0.00 (tax incl.)

EpiMelt ARHGAP29 Methylated and Non-Methylated assay specific control Control set

Reference: EpiMeltARHGAP29_Both

€0.00 (tax incl.)

The EpiMelt ARHGAP29 kit contains a set of methylated and non - methylated ready to use assay specific controls for 100 PCRs

CRISPR rtTA (Dox-On) Cas9 pRTCE2Bla-TRE-Cas9-EFS-rtTA-2A-Blast (plasmid)

Reference: SVRTC9E2B-PS

€0.00 (tax incl.)

EpiMelt ARX Methylated assay specific control

Reference: EpiMeltARX_M

€0.00 (tax incl.)

The EpiMelt ARX kit contains methylated ready to use assay specific controls for 100 PCRs

CRISPR rtTA (Dox-On) Cas9 pRTCE2Bla-TRE-Cas9-EFS-rtTA-2A-Blast (virus)

Reference: SVRTC9E2B-VS

€0.00 (tax incl.)

Cas9 in All-in-One Dox-On Cloning Vector (pTMONBla-TRE-MCS-EFS-rtTA-2A-Blast)

EpiMelt ARX Non-Methylated assay specific control

Reference: EpiMeltARX_NM

€0.00 (tax incl.)

The EpiMelt ARX kit contains non-methylated ready to use assay specific controls for 100 PCRs

CRISPR Cas9 pRCE2B-EFS-Cas9-2A-Blast (plasmid)

Reference: SVC9E2B-PS

€0.00 (tax incl.)

EpiMelt ARX Methylated and Non-Methylated assay specific control Control set

Reference: EpiMeltARX_Both

€0.00 (tax incl.)

The EpiMelt ARX kit contains a set of methylated and non - methylated ready to use assay specific controls for 100 PCRs

CRISPR Cas9 pRCE2B-EFS-Cas9-2A-Blast (virus)

Reference: SVC9E2B-VS

€0.00 (tax incl.)

EpiMelt ASNS Methylated assay specific control

Reference: EpiMeltASNS_M

€0.00 (tax incl.)

The EpiMelt ASNS kit contains methylated ready to use assay specific controls for 100 PCRs

CRISPR Cas9 pRCCG-CMV-Cas9-2A-GFP (plasmid)

Reference: SVC9G-PS

€0.00 (tax incl.)

EpiMelt ASNS Non-Methylated assay specific control

Reference: EpiMeltASNS_NM

€0.00 (tax incl.)

The EpiMelt ASNS kit contains non-methylated ready to use assay specific controls for 100 PCRs

CRISPR Cas9 pRCCG-CMV-Cas9-2A-GFP (virus)

Reference: SVC9G-VS

€0.00 (tax incl.)

EpiMelt ASNS Methylated and Non-Methylated assay specific control Control set

Reference: EpiMeltASNS_Both

€0.00 (tax incl.)

The EpiMelt ASNS kit contains a set of methylated and non - methylated ready to use assay specific controls for 100 PCRs

CRISPR Cas9 pRCCN-CMV-Cas9-2A-Neo (plasmid)

Reference: SVC9N-PS

€0.00 (tax incl.)

EpiMelt ASXL1 Methylated assay specific control

Reference: EpiMeltASXL1_M

€0.00 (tax incl.)

The EpiMelt ASXL1 kit contains methylated ready to use assay specific controls for 100 PCRs

CRISPR Cas9 pRCCN-CMV-Cas9-2A-Neo (virus)

Reference: SVC9N-VS

€0.00 (tax incl.)

EpiMelt ASXL1 Non-Methylated assay specific control

Reference: EpiMeltASXL1_NM

€0.00 (tax incl.)

The EpiMelt ASXL1 kit contains non-methylated ready to use assay specific controls for 100 PCRs

CRISPR Cas9 pRCCP-CMV-Cas9-2A-Puro (plasmid)

Reference: SVC9P-PS

€0.00 (tax incl.)

EpiMelt ASXL1 Methylated and Non-Methylated assay specific control Control set

Reference: EpiMeltASXL1_Both

€0.00 (tax incl.)

The EpiMelt ASXL1 kit contains a set of methylated and non - methylated ready to use assay specific controls for 100 PCRs

CRISPR Cas9 pRCCP-CMV-Cas9-2A-Puro (virus)

Reference: SVC9P-VS

€0.00 (tax incl.)

EpiMelt ASXL2 Methylated assay specific control

Reference: EpiMeltASXL2_M

€0.00 (tax incl.)

The EpiMelt ASXL2 kit contains methylated ready to use assay specific controls for 100 PCRs

CRISPR Cas9 pRCCR-CMV-Cas9-2A-RFP (plasmid)

Reference: SVC9R-PS

€0.00 (tax incl.)

EpiMelt ASXL2 Non-Methylated assay specific control

Reference: EpiMeltASXL2_NM

€0.00 (tax incl.)

The EpiMelt ASXL2 kit contains non-methylated ready to use assay specific controls for 100 PCRs

CRISPR Cas9 pRCCR-CMV-Cas9-2A-RFP (virus)

Reference: SVC9R-VS

€0.00 (tax incl.)

EpiMelt ASXL2 Methylated and Non-Methylated assay specific control Control set

Reference: EpiMeltASXL2_Both

€0.00 (tax incl.)

The EpiMelt ASXL2 kit contains a set of methylated and non - methylated ready to use assay specific controls for 100 PCRs

CRISPR Cas9 pRCRB-RSV-Cas9-2A-Blast (plasmid)

Reference: SVC9RB-PS

€0.00 (tax incl.)

Category: Genetics

Menu

Settings