Quote 
Reference: SHCTL-LUC-pRSI16-V
€0.00
(tax incl.)
Filter By
Filter By
Category: Genetics
Filter By
Reference: EpiMeltALX4_NM
€0.00
(tax incl.)
The EpiMelt ALX4 kit contains non-methylated ready to use assay specific controls for 100 PCRs
Reference: SHCTL-LUC-pRSI17
€0.00
(tax incl.)
Reference: EpiMeltALX4_Both
€0.00
(tax incl.)
The EpiMelt ALX4 kit contains a set of methylated and non - methylated ready to use assay specific controls for 100 PCRs
Reference: SHCTL-LUC-pRSI17-V
€0.00
(tax incl.)
Reference: EpiMeltANAPC5_M
€0.00
(tax incl.)
The EpiMelt ANAPC5 kit contains methylated ready to use assay specific controls for 100 PCRs
Reference: SHCTL-LUC-pRSIT16
€0.00
(tax incl.)
Reference: EpiMeltANAPC5_NM
€0.00
(tax incl.)
The EpiMelt ANAPC5 kit contains non-methylated ready to use assay specific controls for 100 PCRs
Reference: SHCTL-LUC-pRSIT16-V
€0.00
(tax incl.)
Reference: EpiMeltANAPC5_Both
€0.00
(tax incl.)
The EpiMelt ANAPC5 kit contains a set of methylated and non - methylated ready to use assay specific controls for 100 PCRs
Reference: SHCTL-LUC-pRSIT17
€0.00
(tax incl.)
Reference: EpiMeltAPAF1_M
€0.00
(tax incl.)
The EpiMelt APAF1 kit contains methylated ready to use assay specific controls for 100 PCRs
Reference: SHCTL-LUC-pRSIT17-V
€0.00
(tax incl.)
Reference: EpiMeltAPAF1_NM
€0.00
(tax incl.)
The EpiMelt APAF1 kit contains non-methylated ready to use assay specific controls for 100 PCRs
Reference: SHCTL-NT-pRSI16
€0.00
(tax incl.)
shNT is OK for Human and Mouse
Reference: EpiMeltAPAF1_Both
€0.00
(tax incl.)
The EpiMelt APAF1 kit contains a set of methylated and non - methylated ready to use assay specific controls for 100 PCRs
Reference: SHCTL-NT-pRSI16-V
€0.00
(tax incl.)
shNT is OK for Human and Mouse
Reference: EpiMeltAPBA1_M
€0.00
(tax incl.)
The EpiMelt APBA1 kit contains methylated ready to use assay specific controls for 100 PCRs
Reference: SHCTL-NT-pRSI17
€0.00
(tax incl.)
shNT is OK for Human and Mouse
Reference: EpiMeltAPBA1_NM
€0.00
(tax incl.)
The EpiMelt APBA1 kit contains non-methylated ready to use assay specific controls for 100 PCRs
Reference: SHCTL-NT-pRSI17-V
€0.00
(tax incl.)
shNT is OK for Human and Mouse
Reference: EpiMeltAPBA1_Both
€0.00
(tax incl.)
The EpiMelt APBA1 kit contains a set of methylated and non - methylated ready to use assay specific controls for 100 PCRs
Reference: SHCTL-NT-pRSIT16
€0.00
(tax incl.)
shNT is OK for Human and Mouse
Reference: EpiMeltAPC_M
€0.00
(tax incl.)
The EpiMelt APC kit contains methylated ready to use assay specific controls for 100 PCRs
Reference: SHCTL-NT-pRSIT16-V
€0.00
(tax incl.)
shNT is OK for Human and Mouse
Reference: EpiMeltAPC_NM
€0.00
(tax incl.)
The EpiMelt APC kit contains non-methylated ready to use assay specific controls for 100 PCRs
Reference: SHCTL-NT-pRSIT17
€0.00
(tax incl.)
shNT is OK for Human and Mouse
Reference: EpiMeltAPC_Both
€0.00
(tax incl.)
The EpiMelt APC kit contains a set of methylated and non - methylated ready to use assay specific controls for 100 PCRs
Reference: SHCTL-NT-pRSIT17-V
€0.00
(tax incl.)
shNT is OK for Human and Mouse
Reference: EpiMeltAPEX1_M
€0.00
(tax incl.)
The EpiMelt APEX1 kit contains methylated ready to use assay specific controls for 100 PCRs
Reference: SVCOPG-P
€0.00
(tax incl.)
Reference: EpiMeltAPEX1_NM
€0.00
(tax incl.)
The EpiMelt APEX1 kit contains non-methylated ready to use assay specific controls for 100 PCRs
Reference: SVCOPG-V
€0.00
(tax incl.)
Reference: EpiMeltAPEX1_Both
€0.00
(tax incl.)
The EpiMelt APEX1 kit contains a set of methylated and non - methylated ready to use assay specific controls for 100 PCRs
Reference: BCXP3RP-P
€0.00
(tax incl.)
Barcode seq NOT in CloneTracker XP™ 1M/10M Lib (pScribe4/5/6)
Reference: EpiMeltAPP_M
€0.00
(tax incl.)
The EpiMelt APP kit contains methylated ready to use assay specific controls for 100 PCRs
Reference: BCXP3RP-V
€0.00
(tax incl.)
Barcode seq NOT in CloneTracker XP™ 1M/10M Lib (pScribe4/5/6)
Reference: EpiMeltAPP_NM
€0.00
(tax incl.)
The EpiMelt APP kit contains non-methylated ready to use assay specific controls for 100 PCRs
Single Barcode-3' Construct in pScribe5-Venus-Puro, compatible with CloneTracker XP 1M/10M (plasmid)
Reference: BCXP3VP-P
€0.00
(tax incl.)
Barcode seq NOT in CloneTracker XP™ 1M/10M Lib (pScribe4/5/6)
Reference: EpiMeltAPP_Both
€0.00
(tax incl.)
The EpiMelt APP kit contains a set of methylated and non - methylated ready to use assay specific controls for 100 PCRs
Reference: BCXP3VP-V
€0.00
(tax incl.)
Barcode seq NOT in CloneTracker XP™ 1M/10M Lib (pScribe4/5/6)
Reference: EpiMeltAR_M
€0.00
(tax incl.)
The EpiMelt AR kit contains methylated ready to use assay specific controls for 100 PCRs
Reference: BCXP3RPM-P
€0.00
(tax incl.)
Barcode seq NOT in CloneTracker XP™ 5M/50M Lib (pScribe4M/5M/6M) - BC14(ACACCAGTTGTGCA)-21nt-BC30(TGCATGGTCAGTTGCATGGTCAACACGTCA)
Reference: EpiMeltAR_NM
€0.00
(tax incl.)
The EpiMelt AR kit contains non-methylated ready to use assay specific controls for 100 PCRs
Reference: BCXP3RPM-V
€0.00
(tax incl.)
Barcode seq NOT in CloneTracker XP™ 5M/50M Lib (pScribe4M/5M/6M) - BC14(ACACCAGTTGTGCA)-21nt-BC30(TGCATGGTCAGTTGCATGGTCAACACGTCA)
Reference: EpiMeltAR_Both
€0.00
(tax incl.)
The EpiMelt AR kit contains a set of methylated and non - methylated ready to use assay specific controls for 100 PCRs
Reference: BCXP3RHM-P
€0.00
(tax incl.)
Barcode sequence is NOT in CloneTracker XP™ 5M/50M Libraries (pScribe4M/5M/6M)) - BC14(ACACCAGTTGTGCA)-21nt-BC30(TGCATGGTCAGTTGCATGGTCAACACGTCA)
Reference: EpiMeltARF4_M
€0.00
(tax incl.)
The EpiMelt ARF4 kit contains methylated ready to use assay specific controls for 100 PCRs
Reference: BCXP3RHM-V
€0.00
(tax incl.)
Barcode seq NOT in CloneTracker XP™ 5M/50M Lib (pScribe4M/5M/6M) - BC14(ACACCAGTTGTGCA)-21nt-BC30(TGCATGGTCAGTTGCATGGTCAACACGTCA)
Reference: EpiMeltARF4_NM
€0.00
(tax incl.)
The EpiMelt ARF4 kit contains non-methylated ready to use assay specific controls for 100 PCRs
Reference: EpiMeltARF4_Both
€0.00
(tax incl.)
The EpiMelt ARF4 kit contains a set of methylated and non - methylated ready to use assay specific controls for 100 PCRs
Reference: EpiMeltARHGAP29_M
€0.00
(tax incl.)
The EpiMelt ARHGAP29 kit contains methylated ready to use assay specific controls for 100 PCRs
Reference: EpiMeltARHGAP29_NM
€0.00
(tax incl.)
The EpiMelt ARHGAP29 kit contains non-methylated ready to use assay specific controls for 100 PCRs
Reference: EpiMeltARHGAP29_Both
€0.00
(tax incl.)
The EpiMelt ARHGAP29 kit contains a set of methylated and non - methylated ready to use assay specific controls for 100 PCRs
Reference: SVRTC9E2B-PS
€0.00
(tax incl.)
Reference: EpiMeltARX_M
€0.00
(tax incl.)
The EpiMelt ARX kit contains methylated ready to use assay specific controls for 100 PCRs
Reference: SVRTC9E2B-VS
€0.00
(tax incl.)
Cas9 in All-in-One Dox-On Cloning Vector (pTMONBla-TRE-MCS-EFS-rtTA-2A-Blast)
Reference: EpiMeltARX_NM
€0.00
(tax incl.)
The EpiMelt ARX kit contains non-methylated ready to use assay specific controls for 100 PCRs
Reference: EpiMeltARX_Both
€0.00
(tax incl.)
The EpiMelt ARX kit contains a set of methylated and non - methylated ready to use assay specific controls for 100 PCRs
Reference: EpiMeltASNS_M
€0.00
(tax incl.)
The EpiMelt ASNS kit contains methylated ready to use assay specific controls for 100 PCRs
Reference: EpiMeltASNS_NM
€0.00
(tax incl.)
The EpiMelt ASNS kit contains non-methylated ready to use assay specific controls for 100 PCRs
Reference: EpiMeltASNS_Both
€0.00
(tax incl.)
The EpiMelt ASNS kit contains a set of methylated and non - methylated ready to use assay specific controls for 100 PCRs
Reference: EpiMeltASXL1_M
€0.00
(tax incl.)
The EpiMelt ASXL1 kit contains methylated ready to use assay specific controls for 100 PCRs
Reference: EpiMeltASXL1_NM
€0.00
(tax incl.)
The EpiMelt ASXL1 kit contains non-methylated ready to use assay specific controls for 100 PCRs
Reference: EpiMeltASXL1_Both
€0.00
(tax incl.)
The EpiMelt ASXL1 kit contains a set of methylated and non - methylated ready to use assay specific controls for 100 PCRs
Reference: EpiMeltASXL2_M
€0.00
(tax incl.)
The EpiMelt ASXL2 kit contains methylated ready to use assay specific controls for 100 PCRs
Reference: EpiMeltASXL2_NM
€0.00
(tax incl.)
The EpiMelt ASXL2 kit contains non-methylated ready to use assay specific controls for 100 PCRs
Reference: EpiMeltASXL2_Both
€0.00
(tax incl.)
The EpiMelt ASXL2 kit contains a set of methylated and non - methylated ready to use assay specific controls for 100 PCRs
Reference: EpiMeltATF2_M
€0.00
(tax incl.)
The EpiMelt ATF2 kit contains methylated ready to use assay specific controls for 100 PCRs
Reference: EpiMeltATF2_NM
€0.00
(tax incl.)
The EpiMelt ATF2 kit contains non-methylated ready to use assay specific controls for 100 PCRs
Reference: EpiMeltATF2_Both
€0.00
(tax incl.)
The EpiMelt ATF2 kit contains a set of methylated and non - methylated ready to use assay specific controls for 100 PCRs
Reference: EpiMeltATF4_M
€0.00
(tax incl.)
The EpiMelt ATF4 kit contains methylated ready to use assay specific controls for 100 PCRs
Reference: SVKRABC9B-PS
€0.00
(tax incl.)
Reference: EpiMeltATF4_NM
€0.00
(tax incl.)
The EpiMelt ATF4 kit contains non-methylated ready to use assay specific controls for 100 PCRs
Reference: SVKRABC9B-VS
€0.00
(tax incl.)
Reference: EpiMeltATF4_Both
€0.00
(tax incl.)
The EpiMelt ATF4 kit contains a set of methylated and non - methylated ready to use assay specific controls for 100 PCRs
Reference: SVKRABC9E2B-PS
€0.00
(tax incl.)
Reference: EpiMeltATM_M
€0.00
(tax incl.)
The EpiMelt ATM kit contains methylated ready to use assay specific controls for 100 PCRs
Reference: SVKRABC9E2B-VS
€0.00
(tax incl.)
Reference: EpiMeltATM_NM
€0.00
(tax incl.)
The EpiMelt ATM kit contains non-methylated ready to use assay specific controls for 100 PCRs
Reference: SVKRABC9H-PS
€0.00
(tax incl.)
Reference: EpiMeltATM_Both
€0.00
(tax incl.)
The EpiMelt ATM kit contains a set of methylated and non - methylated ready to use assay specific controls for 100 PCRs