Filter By
Filter By
Category: Genetics
Filter By
Reference: SGCTL-NT-pRSG21-V
€0.00
(tax incl.)
sgNT (CTRL0003) gRNA Seq: 5'-GGCAGTCGTTCGGTTGATAT-3' (OK for Human and Mouse)
Reference: SGCTL-NT-pRSGT16
€0.00
(tax incl.)
sgNT (CTRL0003) gRNA Seq: 5'-GGCAGTCGTTCGGTTGATAT-3' (OK for Human and Mouse)
Reference: SGCTL-NT-pRSGT16-V
€0.00
(tax incl.)
sgNT (CTRL0003) gRNA Seq: 5'-GGCAGTCGTTCGGTTGATAT-3' (OK for Human and Mouse)
Reference: SGCTL-NT-pRSGT17
€0.00
(tax incl.)
sgNT (CTRL0003) gRNA Seq: 5'-GGCAGTCGTTCGGTTGATAT-3' (OK for Human and Mouse)
Reference: SGCTL-NT-pRSGT17-V
€0.00
(tax incl.)
sgNT (CTRL0003) gRNA Seq: 5'-GGCAGTCGTTCGGTTGATAT-3' (OK for Human and Mouse)
Reference: SGCTL-2NT-pRSL10
€0.00
(tax incl.)
Reference: SGCTL-2NT-pRSL10-V
€0.00
(tax incl.)
Reference: SHCTL-LUC-pRSI16
€0.00
(tax incl.)
Reference: SHCTL-LUC-pRSI16-V
€0.00
(tax incl.)
Reference: SHCTL-LUC-pRSI17
€0.00
(tax incl.)
Reference: HY-R01866
€0.00
(tax incl.)
hsa-miR-610 mimics are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.
Reference: SHCTL-LUC-pRSI17-V
€0.00
(tax incl.)
Reference: HY-R02807
€0.00
(tax incl.)
mmu-miR-1a-2-5p mimics are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.
Reference: SHCTL-LUC-pRSIT16
€0.00
(tax incl.)
Reference: HY-R03013
€0.00
(tax incl.)
mmu-miR-3113-3p mimics are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.
Reference: SHCTL-LUC-pRSIT16-V
€0.00
(tax incl.)
Reference: HY-R01887
€0.00
(tax incl.)
hsa-miR-618 mimics are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.
Reference: SHCTL-LUC-pRSIT17
€0.00
(tax incl.)
Reference: HY-R02449
€0.00
(tax incl.)
hsa-miR-8057 mimics are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.
Reference: SHCTL-LUC-pRSIT17-V
€0.00
(tax incl.)
Reference: HY-R03112
€0.00
(tax incl.)
mmu-miR-376c-5p mimics are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.
Reference: SHCTL-NT-pRSI16
€0.00
(tax incl.)
shNT is OK for Human and Mouse
Reference: HY-R02379
€0.00
(tax incl.)
hsa-miR-7153-3p mimics are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.
Reference: SHCTL-NT-pRSI16-V
€0.00
(tax incl.)
shNT is OK for Human and Mouse
Reference: HY-R00869
€0.00
(tax incl.)
hsa-miR-3912-3p mimics are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.
Reference: SHCTL-NT-pRSI17
€0.00
(tax incl.)
shNT is OK for Human and Mouse
Reference: HY-R03273
€0.00
(tax incl.)
mmu-miR-5128 mimics are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.
Reference: SHCTL-NT-pRSI17-V
€0.00
(tax incl.)
shNT is OK for Human and Mouse
Reference: HY-R03612
€0.00
(tax incl.)
mmu-miR-6943-5p mimics are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.
Reference: SHCTL-NT-pRSIT16
€0.00
(tax incl.)
shNT is OK for Human and Mouse
Reference: HY-R01299
€0.00
(tax incl.)
hsa-miR-4712-3p mimics are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.
Reference: SHCTL-NT-pRSIT16-V
€0.00
(tax incl.)
shNT is OK for Human and Mouse
Reference: HY-R01547
€0.00
(tax incl.)
hsa-miR-513c-5p mimics are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.
Reference: SHCTL-NT-pRSIT17
€0.00
(tax incl.)
shNT is OK for Human and Mouse
Reference: HY-R01389
€0.00
(tax incl.)
hsa-miR-4766-3p mimics are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.
Reference: SHCTL-NT-pRSIT17-V
€0.00
(tax incl.)
shNT is OK for Human and Mouse
Reference: HY-R00756
€0.00
(tax incl.)
hsa-miR-3650 mimics are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.
Reference: SVCOPG-P
€0.00
(tax incl.)
Reference: HY-132589
€0.00
(tax incl.)
Vutrisiran (ALN-TTRsc02) is a liver-directed, investigational, small interfering ribonucleic acid (siRNA) agent. Vutrisiran can be used for transthyretin (TTR)-mediated amyloidosis research.
Reference: SVCOPG-V
€0.00
(tax incl.)
Reference: HY-R03559
€0.00
(tax incl.)
mmu-miR-6919-3p mimics are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.
Reference: BCXP3RP-P
€0.00
(tax incl.)
Barcode seq NOT in CloneTracker XP™ 1M/10M Lib (pScribe4/5/6)
Reference: HY-R00646
€0.00
(tax incl.)
hsa-miR-3186-3p mimics are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.
Reference: BCXP3RP-V
€0.00
(tax incl.)
Barcode seq NOT in CloneTracker XP™ 1M/10M Lib (pScribe4/5/6)
Reference: HY-R01858
€0.00
(tax incl.)
hsa-miR-6083 mimics are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.
Single Barcode-3' Construct in pScribe5-Venus-Puro, compatible with CloneTracker XP 1M/10M (plasmid)
Reference: BCXP3VP-P
€0.00
(tax incl.)
Barcode seq NOT in CloneTracker XP™ 1M/10M Lib (pScribe4/5/6)
Reference: HY-12695B
€0.00
(tax incl.)
5'-GTP trisodium salt hydrate is an activator of the signal transducing G proteins and also serves as an energy-rich precursor of mononucleotide units in the enzymatic biosynthesis of DNA and RNA.
Reference: BCXP3VP-V
€0.00
(tax incl.)
Barcode seq NOT in CloneTracker XP™ 1M/10M Lib (pScribe4/5/6)
Reference: HY-R01854
€0.00
(tax incl.)
hsa-miR-608 mimics are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.
Reference: BCXP3RPM-P
€0.00
(tax incl.)
Barcode seq NOT in CloneTracker XP™ 5M/50M Lib (pScribe4M/5M/6M) - BC14(ACACCAGTTGTGCA)-21nt-BC30(TGCATGGTCAGTTGCATGGTCAACACGTCA)
Reference: HY-R02867
€0.00
(tax incl.)
mmu-miR-291a-5p mimics are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.
Reference: BCXP3RPM-V
€0.00
(tax incl.)
Barcode seq NOT in CloneTracker XP™ 5M/50M Lib (pScribe4M/5M/6M) - BC14(ACACCAGTTGTGCA)-21nt-BC30(TGCATGGTCAGTTGCATGGTCAACACGTCA)
Reference: HY-R04353
€0.00
(tax incl.)
rno-miR-328b-3p mimics are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.
Reference: BCXP3RHM-P
€0.00
(tax incl.)
Barcode sequence is NOT in CloneTracker XP™ 5M/50M Libraries (pScribe4M/5M/6M)) - BC14(ACACCAGTTGTGCA)-21nt-BC30(TGCATGGTCAGTTGCATGGTCAACACGTCA)
Reference: HY-R00888
€0.00
(tax incl.)
hsa-miR-3927-3p mimics are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.
Reference: BCXP3RHM-V
€0.00
(tax incl.)
Barcode seq NOT in CloneTracker XP™ 5M/50M Lib (pScribe4M/5M/6M) - BC14(ACACCAGTTGTGCA)-21nt-BC30(TGCATGGTCAGTTGCATGGTCAACACGTCA)
Reference: HY-R04499
€0.00
(tax incl.)
rno-miR-501-3p mimics are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.
Reference: HY-R04362
€0.00
(tax incl.)
rno-miR-343 mimics are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.
Reference: HY-R03149
€0.00
(tax incl.)
mmu-miR-449c-5p mimics are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.
Reference: HY-R00671
€0.00
(tax incl.)
hsa-miR-320a-3p mimics are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.
Reference: HY-R04504
€0.00
(tax incl.)
rno-miR-509-3p mimics are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.
Reference: SVRTC9E2B-PS
€0.00
(tax incl.)
Reference: HY-R01827
€0.00
(tax incl.)
hsa-miR-595 mimics are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.
Reference: SVRTC9E2B-VS
€0.00
(tax incl.)
Cas9 in All-in-One Dox-On Cloning Vector (pTMONBla-TRE-MCS-EFS-rtTA-2A-Blast)
Reference: HY-R01910
€0.00
(tax incl.)
hsa-miR-636 mimics are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.
Reference: HY-R02131
€0.00
(tax incl.)
hsa-miR-6783-5p mimics are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.
Reference: HY-152819
€0.00
(tax incl.)
4-Amino-5-iodo-7-(2-β-C-methyl-β-D-ribofuranosyl)-7H-pyrrolo[2,3-d]pyrimidine is a purine nucleoside analogue. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies....
Reference: HY-R04381
€0.00
(tax incl.)
rno-miR-3544 mimics are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.
Reference: HY-R03899
€0.00
(tax incl.)
mmu-miR-7077-3p mimics are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.
Reference: HY-R00400
€0.00
(tax incl.)
hsa-miR-199b-5p mimics are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.
Reference: HY-R02909
€0.00
(tax incl.)
mmu-miR-3062-3p mimics are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.
Reference: HY-R03584
€0.00
(tax incl.)
mmu-miR-6931-3p mimics are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.
Reference: HY-R01852
€0.00
(tax incl.)
hsa-miR-6078 mimics are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.
Reference: HY-R03457
€0.00
(tax incl.)
mmu-miR-669a-5p mimics are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.
Reference: HY-R03798
€0.00
(tax incl.)
mmu-miR-703 mimics are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.