CRISPR Module B Human Genome 80K Knockout-B Library (virus, sgRNA do not overlap with KOHGW-80K-P) Reference: KOHGW-80K-B-V9 €0.00 (tax incl.)
CRISPR Human Genome 80K Knockout Library in EF1-Puro Vector (plasmid) Reference: KOHGW-EP-80K-P €0.00 (tax incl.)
CRISPR Human Genome 80K Knockout Library in EF1-Puro Vector (virus) Reference: KOHGW-EP-80K-V8 €0.00 (tax incl.)
CRISPR Human Genome 80K Knockout Library in EF1-Puro Vector (virus) Reference: KOHGW-EP-80K-V9 €0.00 (tax incl.)
CRISPR Human Genome Knockout Library, Modules 1, 2, & 3 (plasmid) Reference: KOHGW-M123-P €0.00 (tax incl.)
sgCopGFP Control (copGFP targeting) in pRSGCCG-U6-(sg)-CMV-Cas9-2A-GFP (plasmid) Reference: SGCCTL-COP-pRSGCCG €0.00 (tax incl.) sgCopGFP (sg_CopGFP_D1) gRNA Seq: 5'-AAGATCGAGTGCCGCATCAC-3'
sgCopGFP Control (copGFP targeting) in pRSGCCG-U6-(sg)-CMV-Cas9-2A-GFP (virus) Reference: SGCCTL-COP-pRSGCCG-V €0.00 (tax incl.) sgCopGFP (sg_CopGFP_D1) gRNA Seq: 5'-AAGATCGAGTGCCGCATCAC-3'
sgCopGFP Control (copGFP targeting) in pRSGCCH-U6-(sg)-CMV-Cas9-2A-Hygro (plasmid) Reference: SGCCTL-COP-pRSGCCH €0.00 (tax incl.) sgCopGFP (sg_CopGFP_D1) gRNA Seq: 5'-AAGATCGAGTGCCGCATCAC-3'
sgCopGFP Control (copGFP targeting) in pRSGCCH-U6-(sg)-CMV-Cas9-2A-Hygro (virus) Reference: SGCCTL-COP-pRSGCCH-V €0.00 (tax incl.) sgCopGFP (sg_CopGFP_D1) gRNA Seq: 5'-AAGATCGAGTGCCGCATCAC-3'
sgCopGFP Control (copGFP targeting) in pRSGCCP-U6-(sg)-CMV-Cas9-2A-Puro (plasmid) Reference: SGCCTL-COP-pRSGCCP €0.00 (tax incl.) sgCopGFP (sg_CopGFP_D1) gRNA Seq: 5'-AAGATCGAGTGCCGCATCAC-3'
sgCopGFP Control (copGFP targeting) in pRSGCCP-U6-(sg)-CMV-Cas9-2A-Puro (virus) Reference: SGCCTL-COP-pRSGCCP-V €0.00 (tax incl.) sgCopGFP (sg_CopGFP_D1) gRNA Seq: 5'-AAGATCGAGTGCCGCATCAC-3'
Non-Targeting CRISPR control in pRSGCCG-U6-(sg)-CMV-Cas9-2A-GFP (plasmid) Reference: SGCCTL-NT-pRSGCCG €0.00 (tax incl.) sgNT (CTRL0003) gRNA Seq: 5'-GGCAGTCGTTCGGTTGATAT-3' (OK for Human and Mouse)
Non-Targeting CRISPR control in pRSGCCG-U6-(sg)-CMV-Cas9-2A-GFP (virus) Reference: SGCCTL-NT-pRSGCCG-V €0.00 (tax incl.) sgNT (CTRL0003) gRNA Seq: 5'-GGCAGTCGTTCGGTTGATAT-3' (OK for Human and Mouse)
Non-Targeting CRISPR control in pRSGCCH-U6-(sg)-CMV-Cas9-2A-Hygro (plasmid) Reference: SGCCTL-NT-pRSGCCH €0.00 (tax incl.) sgNT (CTRL0003) gRNA Seq: 5'-GGCAGTCGTTCGGTTGATAT-3' (OK for Human and Mouse)
Non-Targeting CRISPR control in pRSGCCH-U6-(sg)-CMV-Cas9-2A-Hygro (virus) Reference: SGCCTL-NT-pRSGCCH-V €0.00 (tax incl.) sgNT (CTRL0003) gRNA Seq: 5'-GGCAGTCGTTCGGTTGATAT-3' (OK for Human and Mouse)
Non-Targeting CRISPR control in pRSGCCP-U6-(sg)-CMV-Cas9-2A-Puro (plasmid) Reference: SGCCTL-NT-pRSGCCP €0.00 (tax incl.) sgNT (CTRL0003) gRNA Seq: 5'-GGCAGTCGTTCGGTTGATAT-3' (OK for Human and Mouse)
Non-Targeting CRISPR control in pRSGCCP-U6-(sg)-CMV-Cas9-2A-Puro (virus) Reference: SGCCTL-NT-pRSGCCP-V €0.00 (tax incl.) sgNT (CTRL0003) gRNA Seq: 5'-GGCAGTCGTTCGGTTGATAT-3' (OK for Human and Mouse)
sgCopGFP Control (copGFP targeting) in pRSG16-U6-(sg)-UbiC-RFP-Puro (plasmid) Reference: SGCTL-COP-pRSG16 €0.00 (tax incl.) sgCopGFP (sg_CopGFP_D1) gRNA Seq: 5'-AAGATCGAGTGCCGCATCAC-3'
sgCopGFP Control (copGFP targeting) in pRSG16-U6-(sg)-UbiC-RFP-Puro (virus) Reference: SGCTL-COP-pRSG16-V €0.00 (tax incl.) sgCopGFP (sg_CopGFP_D1) gRNA Seq: 5'-AAGATCGAGTGCCGCATCAC-3'
sgCopGFP Control (copGFP targeting) in pRSG17-U6-(sg)-UbiC-GFP-Puro (plasmid) Reference: SGCTL-COP-pRSG17 €0.00 (tax incl.) sgCopGFP (sg_CopGFP_D1) gRNA Seq: 5'-AAGATCGAGTGCCGCATCAC-3'
sgCopGFP Control (copGFP targeting) in pRSG17-U6-(sg)-UbiC-GFP-Puro (virus) Reference: SGCTL-COP-pRSG17-V €0.00 (tax incl.) sgCopGFP (sg_CopGFP_D1) gRNA Seq: 5'-AAGATCGAGTGCCGCATCAC-3'
sgCopGFP Control (copGFP targeting) in pRSGT16-U6Tet-(sg)-CMV-TetR-RFP-Puro (plasmid) Reference: SGCTL-COP-pRSGT16 €0.00 (tax incl.) sgCopGFP (sg_CopGFP_D1) gRNA Seq: 5'-AAGATCGAGTGCCGCATCAC-3'
sgCopGFP Control (copGFP targeting) in pRSGT16-U6Tet-(sg)-CMV-TetR-RFP-Puro (virus) Reference: SGCTL-COP-pRSGT16-V €0.00 (tax incl.) sgCopGFP (sg_CopGFP_D1) gRNA Seq: 5'-AAGATCGAGTGCCGCATCAC-3'
sgCopGFP Control (copGFP targeting) in pRSGT17-U6Tet-(sg)-CMV-TetR-GFP-Puro Vector (plasmid) Reference: SGCTL-COP-pRSGT17 €0.00 (tax incl.) sgCopGFP (sg_CopGFP_D1) gRNA Seq: 5'-AAGATCGAGTGCCGCATCAC-3'
sgCopGFP Control (copGFP targeting) in pRSGT17-U6Tet-(sg)-CMV-TetR-GFP-Puro (virus) Reference: SGCTL-COP-pRSGT17-V €0.00 (tax incl.) sgCopGFP (sg_CopGFP_D1) gRNA Seq: 5'-AAGATCGAGTGCCGCATCAC-3'
Non-Targeting CRISPR control in pRSG16-U6-(sg)-UbiC-RFP-Puro (plasmid) Reference: SGCTL-NT-pRSG16 €0.00 (tax incl.) sgNT (CTRL0003) gRNA Seq: 5'-GGCAGTCGTTCGGTTGATAT-3' (OK for Human and Mouse)
Non-Targeting CRISPR control in pRSG16-U6-(sg)-UbiC-RFP-Puro (virus) Reference: SGCTL-NT-pRSG16-V €0.00 (tax incl.) sgNT (CTRL0003) gRNA Seq: 5'-GGCAGTCGTTCGGTTGATAT-3' (OK for Human and Mouse)
Non-Targeting CRISPR control in pRSG17-U6-(sg)-UbiC-GFP-Puro (plasmid) Reference: SGCTL-NT-pRSG17 €0.00 (tax incl.) sgNT (CTRL0003) gRNA Seq: 5'-GGCAGTCGTTCGGTTGATAT-3' (OK for Human and Mouse)
Non-Targeting CRISPR control in pRSG17-U6-(sg)-UbiC-GFP-Puro (virus) Reference: SGCTL-NT-pRSG17-V €0.00 (tax incl.) sgNT (CTRL0003) gRNA Seq: 5'-GGCAGTCGTTCGGTTGATAT-3' (OK for Human and Mouse)
Non-Targeting CRISPR control in pRSG21-U6-(sg)-CMV-GFP-Puro (plasmid) Reference: SGCTL-NT-pRSG21 €0.00 (tax incl.) sgNT (CTRL0003) gRNA Seq: 5'-GGCAGTCGTTCGGTTGATAT-3' (OK for Human and Mouse)
Non-Targeting CRISPR control in pRSG21-U6-(sg)-CMV-GFP-Puro (virus) Reference: SGCTL-NT-pRSG21-V €0.00 (tax incl.) sgNT (CTRL0003) gRNA Seq: 5'-GGCAGTCGTTCGGTTGATAT-3' (OK for Human and Mouse)
Non-Targeting CRISPR control in pRSGT16-U6Tet-(sg)-CMV-TetR-RFP-Puro (plasmid) Reference: SGCTL-NT-pRSGT16 €0.00 (tax incl.) sgNT (CTRL0003) gRNA Seq: 5'-GGCAGTCGTTCGGTTGATAT-3' (OK for Human and Mouse)
Non-Targeting CRISPR control in pRSGT16-U6Tet-(sg)-CMV-TetR-RFP-Puro (virus) Reference: SGCTL-NT-pRSGT16-V €0.00 (tax incl.) sgNT (CTRL0003) gRNA Seq: 5'-GGCAGTCGTTCGGTTGATAT-3' (OK for Human and Mouse)
Non-Targeting CRISPR control in pRSGT17-U6Tet-(sg)-CMV-TetR-GFP-Puro Vector (plasmid) Reference: SGCTL-NT-pRSGT17 €0.00 (tax incl.) sgNT (CTRL0003) gRNA Seq: 5'-GGCAGTCGTTCGGTTGATAT-3' (OK for Human and Mouse)
Non-Targeting CRISPR control in pRSGT17-U6Tet-(sg)-CMV-TetR-GFP-Puro (virus) Reference: SGCTL-NT-pRSGT17-V €0.00 (tax incl.) sgNT (CTRL0003) gRNA Seq: 5'-GGCAGTCGTTCGGTTGATAT-3' (OK for Human and Mouse)
Non-Targeting Dual-sgRNA CRISPR control in pRSL10-mU6-sgNT1-hU6-sgNT2-UbiC-TagRFP-2A-puro (plasmid) Reference: SGCTL-2NT-pRSL10 €0.00 (tax incl.)
Non-Targeting Dual-sgRNA CRISPR control in pRSL10-mU6-sgNT1-hU6-sgNT2-UbiC-TagRFP-2A-puro (virus) Reference: SGCTL-2NT-pRSL10-V €0.00 (tax incl.)
shLuc Control (non-targeting) in pRSI16-U6-(sh)-UbiC-RFP-Puro (plasmid) Reference: SHCTL-LUC-pRSI16 €0.00 (tax incl.)
shLuc Control (non-targeting) in pRSI16-U6-(sh)-UbiC-RFP-Puro (virus) Reference: SHCTL-LUC-pRSI16-V €0.00 (tax incl.)
shLuc Control (non-targeting) in pRSI17-U6-(sh)-UbiC-GFP-Puro (plasmid) Reference: SHCTL-LUC-pRSI17 €0.00 (tax incl.)
shLuc Control (non-targeting) in pRSI17-U6-(sh)-UbiC-GFP-Puro (virus) Reference: SHCTL-LUC-pRSI17-V €0.00 (tax incl.)
shLuc Control (non-targeting) in pRSIT16-U6Tet-(sh)-CMV-TetR-RFP-Puro (plasmid) Reference: SHCTL-LUC-pRSIT16 €0.00 (tax incl.)
shLuc Control (non-targeting) in pRSIT16-U6Tet-(sh)-CMV-TetR-RFP-Puro (virus) Reference: SHCTL-LUC-pRSIT16-V €0.00 (tax incl.)
shLuc Control (non-targeting) in pRSIT17-U6Tet-(sh)-CMV-TetR-GFP-Puro (plasmid) Reference: SHCTL-LUC-pRSIT17 €0.00 (tax incl.)
shLuc Control (non-targeting) in pRSIT17-U6Tet-(sh)-CMV-TetR-GFP-Puro (virus) Reference: SHCTL-LUC-pRSIT17-V €0.00 (tax incl.)
shNT Control (non-targeting) in pRSI16-U6-(sh)-UbiC-RFP-Puro (plasmid) Reference: SHCTL-NT-pRSI16 €0.00 (tax incl.) shNT is OK for Human and Mouse
shNT Control (non-targeting) in pRSI16-U6-(sh)-UbiC-RFP-Puro (virus) Reference: SHCTL-NT-pRSI16-V €0.00 (tax incl.) shNT is OK for Human and Mouse
shNT Control (non-targeting) in pRSI17-U6-(sh)-UbiC-GFP-Puro (plasmid) Reference: SHCTL-NT-pRSI17 €0.00 (tax incl.) shNT is OK for Human and Mouse
shNT Control (non-targeting) in pRSI17-U6-(sh)-UbiC-GFP-Puro (virus) Reference: SHCTL-NT-pRSI17-V €0.00 (tax incl.) shNT is OK for Human and Mouse
shNT Control (non-targeting) in pRSIT16-U6Tet-(sh)-CMV-TetR-RFP-Puro (plasmid) Reference: SHCTL-NT-pRSIT16 €0.00 (tax incl.) shNT is OK for Human and Mouse
shNT Control (non-targeting) in pRSIT16-U6Tet-(sh)-CMV-TetR-RFP-Puro (virus) Reference: SHCTL-NT-pRSIT16-V €0.00 (tax incl.) shNT is OK for Human and Mouse
shNT Control (non-targeting) in pRSIT17-U6Tet-(sh)-CMV-TetR-GFP-Puro (plasmid) Reference: SHCTL-NT-pRSIT17 €0.00 (tax incl.) shNT is OK for Human and Mouse
shNT Control (non-targeting) in pRSIT17-U6Tet-(sh)-CMV-TetR-GFP-Puro (virus) Reference: SHCTL-NT-pRSIT17-V €0.00 (tax incl.) shNT is OK for Human and Mouse
CRISPR Target for sgCopGFP Control (pRCdsGEB-CMV-dsCopGFP-EF1-Bleo, plasmid) Reference: SVCOPG-P €0.00 (tax incl.)
CRISPR Target for sgCopGFP Control (pRCdsGEB-CMV-dsCopGFP-EF1-Bleo, virus) Reference: SVCOPG-V €0.00 (tax incl.)
Single Barcode-3' Construct in pScribe4-RFP-Puro, compatible with CloneTracker XP 1M/10M (plasmid) Reference: BCXP3RP-P €0.00 (tax incl.) Barcode seq NOT in CloneTracker XP™ 1M/10M Lib (pScribe4/5/6)
Single Barcode-3' Construct in pScribe4-RFP-Puro, compatible with CloneTracker XP 1M/10M (virus) Reference: BCXP3RP-V €0.00 (tax incl.) Barcode seq NOT in CloneTracker XP™ 1M/10M Lib (pScribe4/5/6)
Single Barcode-3' Construct in pScribe5-Venus-Puro, compatible with CloneTracker XP 1M/10M (plasmid) Reference: BCXP3VP-P €0.00 (tax incl.) Barcode seq NOT in CloneTracker XP™ 1M/10M Lib (pScribe4/5/6)
Single Barcode-3' Construct in pScribe5-Venus-Puro, compatible with CloneTracker XP 1M/10M (virus) Reference: BCXP3VP-V €0.00 (tax incl.) Barcode seq NOT in CloneTracker XP™ 1M/10M Lib (pScribe4/5/6)
Single Barcode-3' Construct in pScribe4M-RFP-Puro, compatible with CloneTracker XP 5M/50M (plasmid) Reference: BCXP3RPM-P €0.00 (tax incl.) Barcode seq NOT in CloneTracker XP™ 5M/50M Lib (pScribe4M/5M/6M) - BC14(ACACCAGTTGTGCA)-21nt-BC30(TGCATGGTCAGTTGCATGGTCAACACGTCA)
Single Barcode-3' Construct in pScribe4M-RFP-Puro, compatible with CloneTracker XP 5M/50M (virus) Reference: BCXP3RPM-V €0.00 (tax incl.) Barcode seq NOT in CloneTracker XP™ 5M/50M Lib (pScribe4M/5M/6M) - BC14(ACACCAGTTGTGCA)-21nt-BC30(TGCATGGTCAGTTGCATGGTCAACACGTCA)
Single Barcode-3' Construct in pScribe4HM-RFP-Hygro, compatible with CloneTracker XP 5M/50M (plasmid) Reference: BCXP3RHM-P €0.00 (tax incl.) Barcode sequence is NOT in CloneTracker XP™ 5M/50M Libraries (pScribe4M/5M/6M)) - BC14(ACACCAGTTGTGCA)-21nt-BC30(TGCATGGTCAGTTGCATGGTCAACACGTCA)
Single Barcode-3' Construct in pScribe4HM-RFP-Hygro, compatible with CloneTracker XP 5M/50M (virus) Reference: BCXP3RHM-V €0.00 (tax incl.) Barcode seq NOT in CloneTracker XP™ 5M/50M Lib (pScribe4M/5M/6M) - BC14(ACACCAGTTGTGCA)-21nt-BC30(TGCATGGTCAGTTGCATGGTCAACACGTCA)
CRISPR rtTA (Dox-On) Cas9 pRTCE2Bla-TRE-Cas9-EFS-rtTA-2A-Blast (plasmid) Reference: SVRTC9E2B-PS €0.00 (tax incl.)
CRISPR rtTA (Dox-On) Cas9 pRTCE2Bla-TRE-Cas9-EFS-rtTA-2A-Blast (virus) Reference: SVRTC9E2B-VS €0.00 (tax incl.) Cas9 in All-in-One Dox-On Cloning Vector (pTMONBla-TRE-MCS-EFS-rtTA-2A-Blast)
CRISPRi dCas9-KRAB pRDKCCB-CMV-dCas9-KRAB-2A-Blast (plasmid) Reference: SVKRABC9B-PS €0.00 (tax incl.)