Quote 
Reference: SHCTL-NT-pRSI17
€0.00
(tax incl.)
shNT is OK for Human and Mouse
Filter By
Filter By
Category: Genetics
Reference: SHCTL-NT-pRSI17-V
€0.00
(tax incl.)
shNT is OK for Human and Mouse
Reference: SHCTL-NT-pRSIT16
€0.00
(tax incl.)
shNT is OK for Human and Mouse
Reference: SHCTL-NT-pRSIT16-V
€0.00
(tax incl.)
shNT is OK for Human and Mouse
Reference: SHCTL-NT-pRSIT17
€0.00
(tax incl.)
shNT is OK for Human and Mouse
Reference: SHCTL-NT-pRSIT17-V
€0.00
(tax incl.)
shNT is OK for Human and Mouse
Reference: SVCOPG-P
€0.00
(tax incl.)
Reference: SVCOPG-V
€0.00
(tax incl.)
Reference: BCXP3RP-P
€0.00
(tax incl.)
Barcode seq NOT in CloneTracker XP™ 1M/10M Lib (pScribe4/5/6)
Reference: BCXP3RP-V
€0.00
(tax incl.)
Barcode seq NOT in CloneTracker XP™ 1M/10M Lib (pScribe4/5/6)
Single Barcode-3' Construct in pScribe5-Venus-Puro, compatible with CloneTracker XP 1M/10M (plasmid)
Reference: BCXP3VP-P
€0.00
(tax incl.)
Barcode seq NOT in CloneTracker XP™ 1M/10M Lib (pScribe4/5/6)
Reference: BCXP3VP-V
€0.00
(tax incl.)
Barcode seq NOT in CloneTracker XP™ 1M/10M Lib (pScribe4/5/6)
Reference: BCXP3RPM-P
€0.00
(tax incl.)
Barcode seq NOT in CloneTracker XP™ 5M/50M Lib (pScribe4M/5M/6M) - BC14(ACACCAGTTGTGCA)-21nt-BC30(TGCATGGTCAGTTGCATGGTCAACACGTCA)
Reference: BCXP3RPM-V
€0.00
(tax incl.)
Barcode seq NOT in CloneTracker XP™ 5M/50M Lib (pScribe4M/5M/6M) - BC14(ACACCAGTTGTGCA)-21nt-BC30(TGCATGGTCAGTTGCATGGTCAACACGTCA)
Reference: BCXP3RHM-P
€0.00
(tax incl.)
Barcode sequence is NOT in CloneTracker XP™ 5M/50M Libraries (pScribe4M/5M/6M)) - BC14(ACACCAGTTGTGCA)-21nt-BC30(TGCATGGTCAGTTGCATGGTCAACACGTCA)
Reference: BCXP3RHM-V
€0.00
(tax incl.)
Barcode seq NOT in CloneTracker XP™ 5M/50M Lib (pScribe4M/5M/6M) - BC14(ACACCAGTTGTGCA)-21nt-BC30(TGCATGGTCAGTTGCATGGTCAACACGTCA)
Reference: SVRTC9E2B-PS
€0.00
(tax incl.)
Reference: SVRTC9E2B-VS
€0.00
(tax incl.)
Cas9 in All-in-One Dox-On Cloning Vector (pTMONBla-TRE-MCS-EFS-rtTA-2A-Blast)
Reference: SVKRABC9B-PS
€0.00
(tax incl.)
Reference: SVKRABC9B-VS
€0.00
(tax incl.)
Reference: SVKRABC9E2B-PS
€0.00
(tax incl.)
Reference: SVKRABC9E2B-VS
€0.00
(tax incl.)
Reference: SVKRABC9H-PS
€0.00
(tax incl.)
Reference: SVKRABC9H-VS
€0.00
(tax incl.)
Reference: SVKRABC9RB-PS
€0.00
(tax incl.)
Reference: SVKRABC9RB-VS
€0.00
(tax incl.)
Reference: SVKRABC9SFB-PS
€0.00
(tax incl.)
Reference: SVKRABC9SFB-VS
€0.00
(tax incl.)
Reference: SVVPHC9E2B-PS
€0.00
(tax incl.)
Reference: SVVPHC9E2B-VS
€0.00
(tax incl.)
Reference: SVVPHC9RB-PS
€0.00
(tax incl.)
Reference: SVVPHC9SFB-PS
€0.00
(tax incl.)
Reference: SVVPHC9SFB-VS
€0.00
(tax incl.)