Category: Research kits

Filter By
Brand: Abbkine Brand: AdipoGen Brand: Biosensis Brand: Microzone Brand: Signalchem Clear all
CheKine™ Lactate Assay Kit CheKine™ Lactate Assay Kit

CheKine™ Lactate Assay Kit

Reference: KTB1100_48T
€0.00 (tax incl.)
CheKine™ Lactate Assay Kit provides a convenient means for detecting L (+) -Lactate in biological samples such as in serum or plasma, cells, culture and fermentation media. In this kit lactate is oxidized by lactate...
DUB Substrate II DUB Substrate II

DUB Substrate II

Reference: S293-57-10
€0.00 (tax incl.)
The SUMO1-based proluciferin substrate is based on the C-terminal derivative of SUMO1.
CheKine™ Lactate Assay Kit CheKine™ Lactate Assay Kit

CheKine™ Lactate Assay Kit

Reference: KTB1100_96T
€0.00 (tax incl.)
CheKine™ Lactate Assay Kit provides a convenient means for detecting L (+) -Lactate in biological samples such as in serum or plasma, cells, culture and fermentation media. In this kit lactate is oxidized by lactate...
DUB Substrate III DUB Substrate III

DUB Substrate III

Reference: N263-57-10
€0.00 (tax incl.)
The NEDD8-based proluciferin substrate is based on the C-terminal derivative of NEDD8.
CheKine™ Lactate Assay Kit CheKine™ Lactate Assay Kit

CheKine™ Lactate Assay Kit

Reference: KTB1100_480T
€0.00 (tax incl.)
CheKine™ Lactate Assay Kit provides a convenient means for detecting L (+) -Lactate in biological samples such as in serum or plasma, cells, culture and fermentation media. In this kit lactate is oxidized by lactate...
DNMT Substrate-1 DNMT Substrate-1

DNMT Substrate-1

Reference: D53-58-05
€0.00 (tax incl.)
The synthetic double-stranded oligonucleotide (Sense: 5’- GATCCGACGACGACGCGCGCGCGACGACGAGATC; Anti-sense: 5’- GATCTCGTCGTCGCGCGCGCGTCGTCGTCGGAC) is used as a substrate for DNA methyltransferase 3A (DNMT3A).
CheKine™ Lactate Dehydrogenase (LDH) Assay Kit CheKine™ Lactate Dehydrogenase (LDH) Assay Kit

CheKine™ Lactate Dehydrogenase (LDH) Assay Kit

Reference: KTB1110_48T
€0.00 (tax incl.)
CheKine™ Lactate Dehydrogenase Assay Kit provides a simple and easy colorimetric assay for measuring Lactate Dehydrogenase in serum, plasma, cell culture supernatants, tissue/cell lysates culture medium, fermentation...
METTL3/METTL14 Substrate METTL3/METTL14 Substrate

METTL3/METTL14 Substrate

Reference: M323-58-025
€0.00 (tax incl.)
The synthetic single-stranded 27 base’s oligo ribo-nucleotide is used as a substrate for assay of methyltransferase METTL3/METTL14 complex.
CheKine™ Lactate Dehydrogenase (LDH) Assay Kit CheKine™ Lactate Dehydrogenase (LDH) Assay Kit

CheKine™ Lactate Dehydrogenase (LDH) Assay Kit

Reference: KTB1110_96T
€0.00 (tax incl.)
CheKine™ Lactate Dehydrogenase Assay Kit provides a simple and easy colorimetric assay for measuring Lactate Dehydrogenase in serum, plasma, cell culture supernatants, tissue/cell lysates culture medium, fermentation...
Poly (1:1 dI, dC) Acid Poly (1:1 dI, dC) Acid

Poly (1:1 dI, dC) Acid

Reference: P62-58-25
€0.00 (tax incl.)
The synthetic poly (deoxyinosinic-deoxycytidylic) acid sodium salt – double-stranded polymer (synthesized as 1:1 ratio) is used as a substrate for DNA methyltransferases.
CheKine™ Lactate Dehydrogenase (LDH) Assay Kit CheKine™ Lactate Dehydrogenase (LDH) Assay Kit

CheKine™ Lactate Dehydrogenase (LDH) Assay Kit

Reference: KTB1110_480T
€0.00 (tax incl.)
CheKine™ Lactate Dehydrogenase Assay Kit provides a simple and easy colorimetric assay for measuring Lactate Dehydrogenase in serum, plasma, cell culture supernatants, tissue/cell lysates culture medium, fermentation...
CheKine™ Glucose Assay Kit CheKine™ Glucose Assay Kit

CheKine™ Glucose Assay Kit

Reference: KTB1300_48T
€0.00 (tax incl.)
CheKine™ Glucose Assay Kit provides simple, direct measurement of glucose concentrations in various biological samples, including serum, plasma, urine, other body fluid, food, growth medium, etc. In this kit, the...
CheKine™ Glucose Assay Kit CheKine™ Glucose Assay Kit

CheKine™ Glucose Assay Kit

Reference: KTB1300_96T
€0.00 (tax incl.)
CheKine™ Glucose Assay Kit provides simple, direct measurement of glucose concentrations in various biological samples, including serum, plasma, urine, other body fluid, food, growth medium, etc. In this kit, the...
CheKine™ Glucose Assay Kit CheKine™ Glucose Assay Kit

CheKine™ Glucose Assay Kit

Reference: KTB1300_192T
€0.00 (tax incl.)
CheKine™ Glucose Assay Kit provides simple, direct measurement of glucose concentrations in various biological samples, including serum, plasma, urine, other body fluid, food, growth medium, etc. In this kit, the...
CheKine™ Glucose Oxidase Activity (GOD) Assay Kit CheKine™ Glucose Oxidase Activity (GOD) Assay Kit

CheKine™ Glucose Oxidase Activity (GOD) Assay Kit

Reference: KTB1310_48T
€0.00 (tax incl.)
CheKine™ Glucose Oxidase Activity Assay Kit provides a simple and easy colorimetric assay for detecting Glucose Oxidase Activity in biological samples such as in serum or plasma, cells, urine, other body fluid, food,...
PI(3)P PI(3)P

PI(3)P

Reference: P421-59-05
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
CheKine™ Glucose Oxidase Activity (GOD) Assay Kit CheKine™ Glucose Oxidase Activity (GOD) Assay Kit

CheKine™ Glucose Oxidase Activity (GOD) Assay Kit

Reference: KTB1310_96T
€0.00 (tax incl.)
CheKine™ Glucose Oxidase Activity Assay Kit provides a simple and easy colorimetric assay for detecting Glucose Oxidase Activity in biological samples such as in serum or plasma, cells, urine, other body fluid, food,...
PI(3)P PI(3)P

PI(3)P

Reference: P421-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
CheKine™ Glucose Oxidase Activity (GOD) Assay Kit CheKine™ Glucose Oxidase Activity (GOD) Assay Kit

CheKine™ Glucose Oxidase Activity (GOD) Assay Kit

Reference: KTB1310_480T
€0.00 (tax incl.)
CheKine™ Glucose Oxidase Activity Assay Kit provides a simple and easy colorimetric assay for detecting Glucose Oxidase Activity in biological samples such as in serum or plasma, cells, urine, other body fluid, food,...
PI(3)P:PS PI(3)P:PS

PI(3)P:PS

Reference: P426-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
CheKine™ Hydrogen Peroxide (H2O2) Assay Kit CheKine™ Hydrogen Peroxide (H2O2) Assay Kit

CheKine™ Hydrogen Peroxide (H2O2) Assay Kit

Reference: KTB1041_48T
€0.00 (tax incl.)
CheKine™ Hydrogen Peroxide Assay Kit provides a simple and easy colorimetric assay for measuring hydrogen peroxide in serum, plasma, cell culture supernatants, tissue/cell lysates and other biological fluids. In the...
PI(3)P:PS PI(3)P:PS

PI(3)P:PS

Reference: P426-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
CheKine™ Hydrogen Peroxide (H2O2) Assay Kit CheKine™ Hydrogen Peroxide (H2O2) Assay Kit

CheKine™ Hydrogen Peroxide (H2O2) Assay Kit

Reference: KTB1041_96T
€0.00 (tax incl.)
CheKine™ Hydrogen Peroxide Assay Kit provides a simple and easy colorimetric assay for measuring hydrogen peroxide in serum, plasma, cell culture supernatants, tissue/cell lysates and other biological fluids. In the...
PI(4)P PI(4)P

PI(4)P

Reference: P422-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
CheKine™ Hydrogen Peroxide (H2O2) Assay Kit CheKine™ Hydrogen Peroxide (H2O2) Assay Kit

CheKine™ Hydrogen Peroxide (H2O2) Assay Kit

Reference: KTB1041_480T
€0.00 (tax incl.)
CheKine™ Hydrogen Peroxide Assay Kit provides a simple and easy colorimetric assay for measuring hydrogen peroxide in serum, plasma, cell culture supernatants, tissue/cell lysates and other biological fluids. In the...
PI(4)P PI(4)P

PI(4)P

Reference: P422-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
CheKine™ Nitric Oxide (NO) Assay Kit CheKine™ Nitric Oxide (NO) Assay Kit

CheKine™ Nitric Oxide (NO) Assay Kit

Reference: KTB1400_48T
€0.00 (tax incl.)
CheKine™ Nitric Oxide Assay Kit is designed to accurately measure NO production following reduction of nitrate to nitrite by using improved Griess method. The Griess assay’s mechanism is summarized as the azo coupling...
PI(4)P:PS PI(4)P:PS

PI(4)P:PS

Reference: P427-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
CheKine™ Nitric Oxide (NO) Assay Kit CheKine™ Nitric Oxide (NO) Assay Kit

CheKine™ Nitric Oxide (NO) Assay Kit

Reference: KTB1400_96T
€0.00 (tax incl.)
CheKine™ Nitric Oxide Assay Kit is designed to accurately measure NO production following reduction of nitrate to nitrite by using improved Griess method. The Griess assay’s mechanism is summarized as the azo coupling...
PI(4)P:PS PI(4)P:PS

PI(4)P:PS

Reference: P427-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
CheKine™ Nitric Oxide (NO) Assay Kit CheKine™ Nitric Oxide (NO) Assay Kit

CheKine™ Nitric Oxide (NO) Assay Kit

Reference: KTB1400_192T
€0.00 (tax incl.)
CheKine™ Nitric Oxide Assay Kit is designed to accurately measure NO production following reduction of nitrate to nitrite by using improved Griess method. The Griess assay’s mechanism is summarized as the azo coupling...
PI(4,5)P2 PI(4,5)P2

PI(4,5)P2

Reference: P424-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
CheKine™ Total Antioxidant Capacity (TAC) Assay Kit CheKine™ Total Antioxidant Capacity (TAC) Assay Kit

CheKine™ Total Antioxidant Capacity (TAC) Assay Kit

Reference: KTB1500_48T
€0.00 (tax incl.)
CheKine™ Total Antioxidant Capacity (TAC) Assay Kit provides a simple and easy colorimetric assay for measuring Total Antioxidant Capacity in serum, plasma, cell culture supernatants, urine, tissue/ cell lysates and...
PI(4,5)P2 PI(4,5)P2

PI(4,5)P2

Reference: P424-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
CheKine™ Total Antioxidant Capacity (TAC) Assay Kit CheKine™ Total Antioxidant Capacity (TAC) Assay Kit

CheKine™ Total Antioxidant Capacity (TAC) Assay Kit

Reference: KTB1500_96T
€0.00 (tax incl.)
CheKine™ Total Antioxidant Capacity (TAC) Assay Kit provides a simple and easy colorimetric assay for measuring Total Antioxidant Capacity in serum, plasma, cell culture supernatants, urine, tissue/ cell lysates and...
PI(4,5)P2:PS PI(4,5)P2:PS

PI(4,5)P2:PS

Reference: P429-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
CheKine™ Total Antioxidant Capacity (TAC) Assay Kit CheKine™ Total Antioxidant Capacity (TAC) Assay Kit

CheKine™ Total Antioxidant Capacity (TAC) Assay Kit

Reference: KTB1500_480T
€0.00 (tax incl.)
CheKine™ Total Antioxidant Capacity (TAC) Assay Kit provides a simple and easy colorimetric assay for measuring Total Antioxidant Capacity in serum, plasma, cell culture supernatants, urine, tissue/ cell lysates and...
PI(4,5)P2:PS PI(4,5)P2:PS

PI(4,5)P2:PS

Reference: P429-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(5)P PI(5)P

PI(5)P

Reference: P423-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(5)P PI(5)P

PI(5)P

Reference: P423-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
CheKine™ Glutathione Oxidized (GSSG) Colorimetric Assay Kit CheKine™ Glutathione Oxidized (GSSG) Colorimetric Assay Kit

CheKine™ Glutathione Oxidized (GSSG) Colorimetric Assay Kit

Reference: KTB1610_48T
€0.00 (tax incl.)
Reduced glutathione can react with DTNB and generate 2-nitro-5-mercaptobenzoic acid, which has the maximum light absorption at 412 nm wavelength. The original reduced glutathione in the sample is inhibited by...
PI(5)P:PS PI(5)P:PS

PI(5)P:PS

Reference: P428-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
CheKine™ Glutathione Oxidized (GSSG) Colorimetric Assay Kit CheKine™ Glutathione Oxidized (GSSG) Colorimetric Assay Kit

CheKine™ Glutathione Oxidized (GSSG) Colorimetric Assay Kit

Reference: KTB1610_96T
€0.00 (tax incl.)
Reduced glutathione can react with DTNB and generate 2-nitro-5-mercaptobenzoic acid, which has the maximum light absorption at 412 nm wavelength. The original reduced glutathione in the sample is inhibited by...
PI(5)P:PS PI(5)P:PS

PI(5)P:PS

Reference: P428-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
CheKine™ Glutathione Oxidized (GSSG) Colorimetric Assay Kit CheKine™ Glutathione Oxidized (GSSG) Colorimetric Assay Kit

CheKine™ Glutathione Oxidized (GSSG) Colorimetric Assay Kit

Reference: KTB1610_96T*5
€0.00 (tax incl.)
Reduced glutathione can react with DTNB and generate 2-nitro-5-mercaptobenzoic acid, which has the maximum light absorption at 412 nm wavelength. The original reduced glutathione in the sample is inhibited by...
PI:PS PI:PS

PI:PS

Reference: P425-59B-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
CheKine™ Glutathione Reductases (GR) Colorimetric Assay Kit CheKine™ Glutathione Reductases (GR) Colorimetric Assay Kit

CheKine™ Glutathione Reductases (GR) Colorimetric Assay Kit

Reference: KTB1620_48T
€0.00 (tax incl.)
GR can catalyze the reduction of NADPH to GSSG to regenerate GSH, and NADPH dehydrogenates to produce NADP +; NADPH has a characteristic absorption peak at 340 nm, while NADP + has no absorption peak at this...
PI:PS PI:PS

PI:PS

Reference: P425-59B-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
CheKine™ Glutathione Reductases (GR) Colorimetric Assay Kit CheKine™ Glutathione Reductases (GR) Colorimetric Assay Kit

CheKine™ Glutathione Reductases (GR) Colorimetric Assay Kit

Reference: KTB1620_96T
€0.00 (tax incl.)
GR can catalyze the reduction of NADPH to GSSG to regenerate GSH, and NADPH dehydrogenates to produce NADP +; NADPH has a characteristic absorption peak at 340 nm, while NADP + has no absorption peak at this...
D-Fructose-6-phosphate D-Fructose-6-phosphate

D-Fructose-6-phosphate

Reference: F520-59-10
€0.00 (tax incl.)
D-Fructose-6-phosphate (sodium salt hydrate) is supplied as a crystalline solid.
CheKine™ Glutathione Reductases (GR) Colorimetric Assay Kit CheKine™ Glutathione Reductases (GR) Colorimetric Assay Kit

CheKine™ Glutathione Reductases (GR) Colorimetric Assay Kit

Reference: KTB1620_192T
€0.00 (tax incl.)
GR can catalyze the reduction of NADPH to GSSG to regenerate GSH, and NADPH dehydrogenates to produce NADP +; NADPH has a characteristic absorption peak at 340 nm, while NADP + has no absorption peak at this...
D-Glucose-6-phosphate D-Glucose-6-phosphate

D-Glucose-6-phosphate

Reference: F521-59-10 mg
€0.00 (tax incl.)
D-glucose-6-phosphate (sodium salt) is supplied as a crystalline solid.
CheKine™ Glutathione Peroxidase (GSH-Px) Colorimetric Assay Kit CheKine™ Glutathione Peroxidase (GSH-Px) Colorimetric Assay Kit

CheKine™ Glutathione Peroxidase (GSH-Px) Colorimetric Assay Kit

Reference: KTB1640_192T
€0.00 (tax incl.)
GSH-Px catalyzes H2O2 to oxidize GSH to produce GSSG; glutathione reductase (GR) catalyzes NADPH to reduce GSSG to regenerate GSH, while NADPH oxidizes to produce NADP+; NADPH has a characteristic absorption peak at...
CheKine™ Thioredoxin Reductase (TrxR) Colorimetric Assay Kit CheKine™ Thioredoxin Reductase (TrxR) Colorimetric Assay Kit

CheKine™ Thioredoxin Reductase (TrxR) Colorimetric Assay Kit

Reference: KTB1650_48T
€0.00 (tax incl.)
TrxR can catalyzes the reduction of DTNB by NADPH to generate TNB and NADP+. TNB has a characteristic absorption peak at 412 nm. TrxR activity can be calculated by measuring the increase rate of TNB at 412 nm.
CheKine™ Thioredoxin Reductase (TrxR) Colorimetric Assay Kit CheKine™ Thioredoxin Reductase (TrxR) Colorimetric Assay Kit

CheKine™ Thioredoxin Reductase (TrxR) Colorimetric Assay Kit

Reference: KTB1650_96T
€0.00 (tax incl.)
TrxR can catalyzes the reduction of DTNB by NADPH to generate TNB and NADP+. TNB has a characteristic absorption peak at 412 nm. TrxR activity can be calculated by measuring the increase rate of TNB at 412 nm.
CheKine™ Thioredoxin Peroxidase (TPX) Colorimetric Assay Kit CheKine™ Thioredoxin Peroxidase (TPX) Colorimetric Assay Kit

CheKine™ Thioredoxin Peroxidase (TPX) Colorimetric Assay Kit

Reference: KTB1660_48T
€0.00 (tax incl.)
TPX catalyzes H2O2 to oxidize dithiothreitol (DTT). The absorption wavelength of H2O2 is 240nm. TPX activity can be calculated by measuring the decrease rate of absorbance at 240nm and subtracting H2O2 catalyzed by...
CheKine™ Thioredoxin Peroxidase (TPX) Colorimetric Assay Kit CheKine™ Thioredoxin Peroxidase (TPX) Colorimetric Assay Kit

CheKine™ Thioredoxin Peroxidase (TPX) Colorimetric Assay Kit

Reference: KTB1660_96T
€0.00 (tax incl.)
TPX catalyzes H2O2 to oxidize dithiothreitol (DTT). The absorption wavelength of H2O2 is 240nm. TPX activity can be calculated by measuring the decrease rate of absorbance at 240nm and subtracting H2O2 catalyzed by...
CheKine™ NADH Oxidase (NOX) Colorimetric Assay Kit CheKine™ NADH Oxidase (NOX) Colorimetric Assay Kit

CheKine™ NADH Oxidase (NOX) Colorimetric Assay Kit

Reference: KTB1021_48T
€0.00 (tax incl.)
NOX can oxidize NADH to NAD, the oxidation of NADH is coupled with the reduction of 2,6 dichlorophenol indigo (DCPIP), the blue DCPIP is reduced to colorless DCPIP, and the reduction rate of blue DCPIP is measured at...
CheKine™ NADH Oxidase (NOX) Colorimetric Assay Kit CheKine™ NADH Oxidase (NOX) Colorimetric Assay Kit

CheKine™ NADH Oxidase (NOX) Colorimetric Assay Kit

Reference: KTB1021_96T
€0.00 (tax incl.)
NOX can oxidize NADH to NAD, the oxidation of NADH is coupled with the reduction of 2,6 dichlorophenol indigo (DCPIP), the blue DCPIP is reduced to colorless DCPIP, and the reduction rate of blue DCPIP is measured at...
CheKine™ Pyruvate Kinase (PK) Colorimetric Assay Kit CheKine™ Pyruvate Kinase (PK) Colorimetric Assay Kit

CheKine™ Pyruvate Kinase (PK) Colorimetric Assay Kit

Reference: KTB1120_48T
€0.00 (tax incl.)
PK catalyzes phosphoenolpyruvate and ADP reaction into ATP and pyruvate, and lactate dehydrogenase further catalyzes the production of lactic acid and NAD + by NADH and pyruvate. The rate of NADH decline at 340 nm can...
CheKine™ Pyruvate Kinase (PK) Colorimetric Assay Kit CheKine™ Pyruvate Kinase (PK) Colorimetric Assay Kit

CheKine™ Pyruvate Kinase (PK) Colorimetric Assay Kit

Reference: KTB1120_96T
€0.00 (tax incl.)
PK catalyzes phosphoenolpyruvate and ADP reaction into ATP and pyruvate, and lactate dehydrogenase further catalyzes the production of lactic acid and NAD + by NADH and pyruvate. The rate of NADH decline at 340 nm can...
CheKine™ Na⁺/K⁺-ATPase Activity Colorimetric Assay Kit CheKine™ Na⁺/K⁺-ATPase Activity Colorimetric Assay Kit

CheKine™ Na⁺/K⁺-ATPase Activity Colorimetric Assay Kit

Reference: KTB1800_48T
€0.00 (tax incl.)
The kit provides a simple method for detecting Na⁺/K⁺-ATPase activity in a variety of biological samples such as serum, plasma, tissues, cells, plants and bacteria. In the assay, Na⁺/K⁺-ATPase catalyzes ATP hydrolysis...
CheKine™ Na⁺/K⁺-ATPase Activity Colorimetric Assay Kit CheKine™ Na⁺/K⁺-ATPase Activity Colorimetric Assay Kit

CheKine™ Na⁺/K⁺-ATPase Activity Colorimetric Assay Kit

Reference: KTB1800_96T
€0.00 (tax incl.)
The kit provides a simple method for detecting Na⁺/K⁺-ATPase activity in a variety of biological samples such as serum, plasma, tissues, cells, plants and bacteria. In the assay, Na⁺/K⁺-ATPase catalyzes ATP hydrolysis...
CheKine™ Ca2⁺/Mg2⁺-ATPase Activity Colorimetric Assay Kit CheKine™ Ca2⁺/Mg2⁺-ATPase Activity Colorimetric Assay Kit

CheKine™ Ca2⁺/Mg2⁺-ATPase Activity Colorimetric Assay Kit

Reference: KTB1810_48T
€0.00 (tax incl.)
The kit provides a simple method for detecting Ca2⁺/Mg2⁺-ATPase activity in a variety of biological samples such as serum, plasma, tissues, cells, plants and bacteria. In the assay, Ca2⁺/Mg2⁺-ATPase catalyzes ATP...
CheKine™ Ca2⁺/Mg2⁺-ATPase Activity Colorimetric Assay Kit CheKine™ Ca2⁺/Mg2⁺-ATPase Activity Colorimetric Assay Kit

CheKine™ Ca2⁺/Mg2⁺-ATPase Activity Colorimetric Assay Kit

Reference: KTB1810_96T
€0.00 (tax incl.)
The kit provides a simple method for detecting Ca2⁺/Mg2⁺-ATPase activity in a variety of biological samples such as serum, plasma, tissues, cells, plants and bacteria. In the assay, Ca2⁺/Mg2⁺-ATPase catalyzes ATP...
CheKine™ Serum Potassium (K+) Colorimetric Assay Kit CheKine™ Serum Potassium (K+) Colorimetric Assay Kit

CheKine™ Serum Potassium (K+) Colorimetric Assay Kit

Reference: KTB2100_96T
€0.00 (tax incl.)
The kit provides a simple method for detecting Potassium (K+) in serum samples. In the assay, potassium ions (K+) react with sodium tetraphenylborate to form potassium tetraphenylborate which is insoluble in water and...
CheKine™ Triglyceride (TG) Colorimetric Assay Kit CheKine™ Triglyceride (TG) Colorimetric Assay Kit

CheKine™ Triglyceride (TG) Colorimetric Assay Kit

Reference: KTB2200_48T
€0.00 (tax incl.)
The kit provides a simple method for detecting TG concentration in a variety of biological samples such as serum, plasma, tissues, cells, and plants. In the assay, TG can be extracted by isopropanol and then...
CheKine™ Triglyceride (TG) Colorimetric Assay Kit CheKine™ Triglyceride (TG) Colorimetric Assay Kit

CheKine™ Triglyceride (TG) Colorimetric Assay Kit

Reference: KTB2200_96T
€0.00 (tax incl.)
The kit provides a simple method for detecting TG concentration in a variety of biological samples such as serum, plasma, tissues, cells, and plants. In the assay, TG can be extracted by isopropanol and then...
CheKine™ Free Cholesterol (FC) Colorimetric Assay Kit CheKine™ Free Cholesterol (FC) Colorimetric Assay Kit

CheKine™ Free Cholesterol (FC) Colorimetric Assay Kit

Reference: KTB2210_48T
€0.00 (tax incl.)
The kit provides a simple method for detecting FC concentration in a variety of biological samples such as serum, plasma, tissues, cells, and bacteria. In the assay, Cholesterol oxidase catalyzes free cholesterol (FC)...
CheKine™ Free Cholesterol (FC) Colorimetric Assay Kit CheKine™ Free Cholesterol (FC) Colorimetric Assay Kit

CheKine™ Free Cholesterol (FC) Colorimetric Assay Kit

Reference: KTB2210_96T
€0.00 (tax incl.)
The kit provides a simple method for detecting FC concentration in a variety of biological samples such as serum, plasma, tissues, cells, and bacteria. In the assay, Cholesterol oxidase catalyzes free cholesterol (FC)...
CheKine™ Total Cholesterol (TC) Colorimetric Assay Kit CheKine™ Total Cholesterol (TC) Colorimetric Assay Kit

CheKine™ Total Cholesterol (TC) Colorimetric Assay Kit

Reference: KTB2220_48T
€0.00 (tax incl.)
The kit provides a simple method for detecting TC concentration in a variety of biological samples such as serum, plasma, tissues, cells, and bacteria. In the assay, esterase catalyzes the hydrolysis of cholesterol...
CheKine™ Total Cholesterol (TC) Colorimetric Assay Kit CheKine™ Total Cholesterol (TC) Colorimetric Assay Kit

CheKine™ Total Cholesterol (TC) Colorimetric Assay Kit

Reference: KTB2220_96T
€0.00 (tax incl.)
The kit provides a simple method for detecting TC concentration in a variety of biological samples such as serum, plasma, tissues, cells, and bacteria. In the assay, esterase catalyzes the hydrolysis of cholesterol...
CheKine™ Pyruvate Acid (PA) Colorimetric Assay Kit CheKine™ Pyruvate Acid (PA) Colorimetric Assay Kit

CheKine™ Pyruvate Acid (PA) Colorimetric Assay Kit

Reference: KTB1121_48T
€0.00 (tax incl.)
The kit provides a simple method for detecting Pyruvate Acid (PA) concentration in a variety of biological samples such as animal tissues, plant tissues, cell culture: adherent or suspension cells, serum, bacterial....
CheKine™ Pyruvate Acid (PA) Colorimetric Assay Kit CheKine™ Pyruvate Acid (PA) Colorimetric Assay Kit

CheKine™ Pyruvate Acid (PA) Colorimetric Assay Kit

Reference: KTB1121_96T
€0.00 (tax incl.)
The kit provides a simple method for detecting Pyruvate Acid (PA) concentration in a variety of biological samples such as animal tissues, plant tissues, cell culture: adherent or suspension cells, serum, bacterial....
CheKine™ Uric Acid (UA) Colorimetric Assay Kit CheKine™ Uric Acid (UA) Colorimetric Assay Kit

CheKine™ Uric Acid (UA) Colorimetric Assay Kit

Reference: KTB1510 _48T
€0.00 (tax incl.)
The kit provides a simple method for detecting Uric Acid (UA) concentration in a variety of biological samples such as animal tissues, serum,urine and other biological fluids. In the assay, Uricase can catalyze UA to...
CheKine™ Uric Acid (UA) Colorimetric Assay Kit CheKine™ Uric Acid (UA) Colorimetric Assay Kit

CheKine™ Uric Acid (UA) Colorimetric Assay Kit

Reference: KTB1510 _96T
€0.00 (tax incl.)
The kit provides a simple method for detecting Uric Acid (UA) concentration in a variety of biological samples such as animal tissues, serum,urine and other biological fluids. In the assay, Uricase can catalyze UA to...
CheKine™ Toal Glutathione (T-GSH) Colorimetric Assay Kit CheKine™ Toal Glutathione (T-GSH) Colorimetric Assay Kit

CheKine™ Toal Glutathione (T-GSH) Colorimetric Assay Kit

Reference: KTB1670_48T
€0.00 (tax incl.)
GSSG is reduced to GSH using Glutathione Reductase (GR). GSH reacts with 5,5'-dithiobis-bis-(2-nitrobenoicacid) to form 2-nitrobenoicacid which has a characteristic absorption peak at 412 nm, the content of total...

Menu

Settings

Please sign in first.

Sign in