Research kits (4)

Modified AKT Substrate II

Reference: A05-58C

€0.00 (tax incl.)

The Modified AKT Substrate II peptide sequence (modified-CKRPRAASFAE) is based on the N-terminus of GSK3.

Modified AXLtide Substrate

Reference: A16-58B

€0.00 (tax incl.)

The Axltide peptide sequence (CKKSRGDYMTMQIG) is based on the mouse Insulin receptor substrate 1 (amino acid 979-989).

Modified PKA Substrate

Reference: C01-58B

€0.00 (tax incl.)

The modified PKA Substrate peptide sequence (modified-CGRTGRRNSI-amide) is based on the cAMP-dependent protein kinase inhibitor alpha (amino acid 15-23).

p38 Substrate

Reference: P03-58

€0.00 (tax incl.)

The synthetic peptide (IPTTPITTTYFFFKKK) contains serine/threonine protein kinase phosphorylation sites and is routinely evaluated as a substrate for p38 family kinases.

PKA Substrate

Reference: C01-58

€0.00 (tax incl.)

The PKA sub peptide sequence (CGRTGRRNSI-amide) is based on the cAMP-dependent protein kinase inhibitor alpha (amino acid 15-23).

PLpro FRET Substrate

Reference: PL01-58-500

€0.00 (tax incl.)

Synthetic FRET peptide substrate specific for PLpro.

PLpro FRET Substrate

Reference: PL01-58-1000

€0.00 (tax incl.)

Synthetic FRET peptide substrate specific for PLpro.

PP1/PP2A Substrate

Reference: P50-58-1000

€0.00 (tax incl.)

The PP1/PP2A Substrate peptide [GRPRTS(p)SFAEG] is derived from human GSK3b (glycogen synthase kinase-3 beta) (amino acids 3-13) and is suitable as PP1 and PP2A substrate.

The PP2B Substrate peptide [DLDVPIPGRFDRRV(p)SVAAE] is derived from bovine PRKAR2A (cAMP-dependent protein kinase type II-alpha regulatory subunit) (amino acids 82-100) and is suitable as PP2B substrate.

RSK Substrate

Reference: S06-58

€0.00 (tax incl.)

The RSK sub peptide sequence (KRRRLSSLRA) is based on human 40S ribosomal protein S6 (amino acid 230-239).

S6K Substrate

Reference: S05-58

€0.00 (tax incl.)

The S6K sub peptide sequence (KRRRLASLR) is based on human 40S ribosomal protein S6 (amino acid 230-238).

SRC Substrate

Reference: S30-58

€0.00 (tax incl.)

The SRC sub peptide sequence (KVEKIGEGTYGVVYK-amide) is based on the p34cdc2 (amino acid 6-20).

Tyrosine Kinase Substrate-3

Reference: T71-58

€0.00 (tax incl.)

The synthetic peptide Tyrosine Kinase Substrate-3 (RRLIEDAEYAARG) is derived from human SRC (amino acid 412-422) and considered to be a generic substrate for various protein tyrosine kinases.

DUB Substrate I

Reference: U06-57-10

€0.00 (tax incl.)

The ubiquitin-based proluciferin substrate is based on the C-terminal derivative of Ubiquitin.

DUB Substrate II

Reference: S293-57-10

€0.00 (tax incl.)

The SUMO1-based proluciferin substrate is based on the C-terminal derivative of SUMO1.

DUB Substrate III

Reference: N263-57-10

€0.00 (tax incl.)

The NEDD8-based proluciferin substrate is based on the C-terminal derivative of NEDD8.

DNMT Substrate-1

Reference: D53-58-05

€0.00 (tax incl.)

The synthetic double-stranded oligonucleotide (Sense: 5’- GATCCGACGACGACGCGCGCGCGACGACGAGATC; Anti-sense: 5’- GATCTCGTCGTCGCGCGCGCGTCGTCGTCGGAC) is used as a substrate for DNA methyltransferase 3A (DNMT3A).

METTL3/METTL14 Substrate

Reference: M323-58-025

€0.00 (tax incl.)

The synthetic single-stranded 27 base’s oligo ribo-nucleotide is used as a substrate for assay of methyltransferase METTL3/METTL14 complex.

Poly (1:1 dI, dC) Acid

Reference: P62-58-25

€0.00 (tax incl.)

The synthetic poly (deoxyinosinic-deoxycytidylic) acid sodium salt – double-stranded polymer (synthesized as 1:1 ratio) is used as a substrate for DNA methyltransferases.

DLG (Dilauroyl-sn-glycerol)

Reference: D430-59-200

€0.00 (tax incl.)

The substrate solution used for assaying Diacylglycerol kinases.

DLG (Dilauroyl-sn-glycerol)

Reference: D430-59-500

€0.00 (tax incl.)

The substrate solution used for assaying Diacylglycerol kinases.