Category: Research kits

Filter By
Brand: Cayman Chemical Brand: Genetex Brand: Krishgen Brand: Microzone Brand: Raybiotech Brand: Signalchem Brand: Vazyme Clear all
Modified AKT Substrate Modified AKT Substrate

Modified AKT Substrate

Reference: A05-58B
€0.00 (tax incl.)
The Modified AKT Substrate peptide sequence (modified-CKRPRAASFAE) is based on the N-terminus of GSK3.
Modified AKT Substrate II Modified AKT Substrate II

Modified AKT Substrate II

Reference: A05-58C
€0.00 (tax incl.)
The Modified AKT Substrate II peptide sequence (modified-CKRPRAASFAE) is based on the N-terminus of GSK3.
Modified AXLtide Substrate Modified AXLtide Substrate

Modified AXLtide Substrate

Reference: A16-58B
€0.00 (tax incl.)
The Axltide peptide sequence (CKKSRGDYMTMQIG) is based on the mouse Insulin receptor substrate 1 (amino acid 979-989).
Modified PKA Substrate Modified PKA Substrate

Modified PKA Substrate

Reference: C01-58B
€0.00 (tax incl.)
The modified PKA Substrate peptide sequence (modified-CGRTGRRNSI-amide) is based on the cAMP-dependent protein kinase inhibitor alpha (amino acid 15-23).
p38 Substrate p38 Substrate

p38 Substrate

Reference: P03-58
€0.00 (tax incl.)
The synthetic peptide (IPTTPITTTYFFFKKK) contains serine/threonine protein kinase phosphorylation sites and is routinely evaluated as a substrate for p38 family kinases.
PKA Substrate PKA Substrate

PKA Substrate

Reference: C01-58
€0.00 (tax incl.)
The PKA sub peptide sequence (CGRTGRRNSI-amide) is based on the cAMP-dependent protein kinase inhibitor alpha (amino acid 15-23).
PLpro FRET Substrate PLpro FRET Substrate

PLpro FRET Substrate

Reference: PL01-58-500
€0.00 (tax incl.)
Synthetic FRET peptide substrate specific for PLpro.
PLpro FRET Substrate PLpro FRET Substrate

PLpro FRET Substrate

Reference: PL01-58-1000
€0.00 (tax incl.)
Synthetic FRET peptide substrate specific for PLpro.
PP1/PP2A Substrate PP1/PP2A Substrate

PP1/PP2A Substrate

Reference: P50-58-1000
€0.00 (tax incl.)
The PP1/PP2A Substrate peptide [GRPRTS(p)SFAEG] is derived from human GSK3b (glycogen synthase kinase-3 beta) (amino acids 3-13) and is suitable as PP1 and PP2A substrate.
PP2B Substrate PP2B Substrate

PP2B Substrate

Reference: P51-58-1000
€0.00 (tax incl.)
The PP2B Substrate peptide [DLDVPIPGRFDRRV(p)SVAAE] is derived from bovine PRKAR2A (cAMP-dependent protein kinase type II-alpha regulatory subunit) (amino acids 82-100) and is suitable as PP2B substrate.
RSK Substrate RSK Substrate

RSK Substrate

Reference: S06-58
€0.00 (tax incl.)
The RSK sub peptide sequence (KRRRLSSLRA) is based on human 40S ribosomal protein S6 (amino acid 230-239).
S6K Substrate S6K Substrate

S6K Substrate

Reference: S05-58
€0.00 (tax incl.)
The S6K sub peptide sequence (KRRRLASLR) is based on human 40S ribosomal protein S6 (amino acid 230-238).
SRC Substrate SRC Substrate

SRC Substrate

Reference: S30-58
€0.00 (tax incl.)
The SRC sub peptide sequence (KVEKIGEGTYGVVYK-amide) is based on the p34cdc2 (amino acid 6-20).
Tyrosine Kinase Substrate-3 Tyrosine Kinase Substrate-3

Tyrosine Kinase Substrate-3

Reference: T71-58
€0.00 (tax incl.)
The synthetic peptide Tyrosine Kinase Substrate-3 (RRLIEDAEYAARG) is derived from human SRC (amino acid 412-422) and considered to be a generic substrate for various protein tyrosine kinases.
DUB Substrate I DUB Substrate I

DUB Substrate I

Reference: U06-57-10
€0.00 (tax incl.)
The ubiquitin-based proluciferin substrate is based on the C-terminal derivative of Ubiquitin.
DUB Substrate II DUB Substrate II

DUB Substrate II

Reference: S293-57-10
€0.00 (tax incl.)
The SUMO1-based proluciferin substrate is based on the C-terminal derivative of SUMO1.
DUB Substrate III DUB Substrate III

DUB Substrate III

Reference: N263-57-10
€0.00 (tax incl.)
The NEDD8-based proluciferin substrate is based on the C-terminal derivative of NEDD8.
DNMT Substrate-1 DNMT Substrate-1

DNMT Substrate-1

Reference: D53-58-05
€0.00 (tax incl.)
The synthetic double-stranded oligonucleotide (Sense: 5’- GATCCGACGACGACGCGCGCGCGACGACGAGATC; Anti-sense: 5’- GATCTCGTCGTCGCGCGCGCGTCGTCGTCGGAC) is used as a substrate for DNA methyltransferase 3A (DNMT3A).
METTL3/METTL14 Substrate METTL3/METTL14 Substrate

METTL3/METTL14 Substrate

Reference: M323-58-025
€0.00 (tax incl.)
The synthetic single-stranded 27 base’s oligo ribo-nucleotide is used as a substrate for assay of methyltransferase METTL3/METTL14 complex.
Poly (1:1 dI, dC) Acid Poly (1:1 dI, dC) Acid

Poly (1:1 dI, dC) Acid

Reference: P62-58-25
€0.00 (tax incl.)
The synthetic poly (deoxyinosinic-deoxycytidylic) acid sodium salt – double-stranded polymer (synthesized as 1:1 ratio) is used as a substrate for DNA methyltransferases.
PI(3)P PI(3)P

PI(3)P

Reference: P421-59-05
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(3)P PI(3)P

PI(3)P

Reference: P421-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(3)P:PS PI(3)P:PS

PI(3)P:PS

Reference: P426-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(3)P:PS PI(3)P:PS

PI(3)P:PS

Reference: P426-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4)P PI(4)P

PI(4)P

Reference: P422-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4)P PI(4)P

PI(4)P

Reference: P422-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4)P:PS PI(4)P:PS

PI(4)P:PS

Reference: P427-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4)P:PS PI(4)P:PS

PI(4)P:PS

Reference: P427-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4,5)P2 PI(4,5)P2

PI(4,5)P2

Reference: P424-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4,5)P2 PI(4,5)P2

PI(4,5)P2

Reference: P424-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4,5)P2:PS PI(4,5)P2:PS

PI(4,5)P2:PS

Reference: P429-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4,5)P2:PS PI(4,5)P2:PS

PI(4,5)P2:PS

Reference: P429-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(5)P PI(5)P

PI(5)P

Reference: P423-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(5)P PI(5)P

PI(5)P

Reference: P423-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(5)P:PS PI(5)P:PS

PI(5)P:PS

Reference: P428-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(5)P:PS PI(5)P:PS

PI(5)P:PS

Reference: P428-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI:PS PI:PS

PI:PS

Reference: P425-59B-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI:PS PI:PS

PI:PS

Reference: P425-59B-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
D-Fructose-6-phosphate D-Fructose-6-phosphate

D-Fructose-6-phosphate

Reference: F520-59-10
€0.00 (tax incl.)
D-Fructose-6-phosphate (sodium salt hydrate) is supplied as a crystalline solid.
D-Glucose-6-phosphate D-Glucose-6-phosphate

D-Glucose-6-phosphate

Reference: F521-59-10 mg
€0.00 (tax incl.)
D-glucose-6-phosphate (sodium salt) is supplied as a crystalline solid.
C-Series Detection Buffer C&D C-Series Detection Buffer C&D

C-Series Detection Buffer C&D

Reference: 0103004-D2
€0.00 (tax incl.)
Detection Buffer C&D for membrane-based Antibody Array Kits (8 array supply).
20X Wash Buffers I and II 20X Wash Buffers I and II

20X Wash Buffers I and II

Reference: 0103004-W
€0.00 (tax incl.)
20X Wash Buffer I and II for Antibody Array Kits, (20 ml each)
CCK-8 Cell Counting Kit CCK-8 Cell Counting Kit

CCK-8 Cell Counting Kit

Reference: A311-01
€0.00 (tax incl.)
CCK-8 Cell Counting Kit, referred to as CCK-8 kit, is dependent on WST-8 (2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5- (2,4-Disulfobenzene)-2H-tetrazole monosodium salt) is a fast, highly sensitive,...
CCK-8 Cell Counting Kit CCK-8 Cell Counting Kit

CCK-8 Cell Counting Kit

Reference: A311-02
€0.00 (tax incl.)
CCK-8 Cell Counting Kit, referred to as CCK-8 kit, is dependent on WST-8 (2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5- (2,4-Disulfobenzene)-2H-tetrazole monosodium salt) is a fast, highly sensitive,...
Dual Luciferase Reporter Assay Kit Dual Luciferase Reporter Assay Kit

Dual Luciferase Reporter Assay Kit

Reference: DL101-01
€0.00 (tax incl.)
The Dual Luciferase Reporter Assay Kit is used to detect the fluorescence intensity of the Luciferin substrate after the reporter plasmid is transfected into the cells, so as to reflect the expression of luciferase...
Add&Read Human IgG Kit Add&Read Human IgG Kit

Add&Read Human IgG Kit

Reference: DD2101-01
€0.00 (tax incl.)
Add&ReadTM Human IgG Kit can be used to detect the concentration of Human IgG (hlgG) in the cell supernatant or after purification. There are two antibodies that recognize hIgG in the kit, namely: the antibody that...
Add&Read Human IgG Kit Add&Read Human IgG Kit

Add&Read Human IgG Kit

Reference: DD2101-02
€0.00 (tax incl.)
Add&ReadTM Human IgG Kit can be used to detect the concentration of Human IgG (hlgG) in the cell supernatant or after purification. There are two antibodies that recognize hIgG in the kit, namely: the antibody that...
Add&Read Human Fc Kit Add&Read Human Fc Kit

Add&Read Human Fc Kit

Reference: DD2102-01
€0.00 (tax incl.)
Add&ReadTM Human Fc Kit can be used to detect the concentration of Human IgG or hFc-fusion protein (hFc-fusion protien) in the cell supernatant or after purification. There is an antibody in the kit that recognizes...
Add&Read Human Fc Kit Add&Read Human Fc Kit

Add&Read Human Fc Kit

Reference: DD2102-02
€0.00 (tax incl.)
Add&ReadTM Human Fc Kit can be used to detect the concentration of Human IgG or hFc-fusion protein (hFc-fusion protien) in the cell supernatant or after purification. There is an antibody in the kit that recognizes...
BCA Protein Quantification Kit BCA Protein Quantification Kit

BCA Protein Quantification Kit

Reference: E112-01
€0.00 (tax incl.)
The BCA Protein Quantification Kit is currently one of the most sensitive protein determination methods. Under alkaline conditions, the protein reduces Cu2+ to Cu+, and Cu+ interacts with the unique BCA Reagent A...
BCA Protein Quantification Kit BCA Protein Quantification Kit

BCA Protein Quantification Kit

Reference: E112-02
€0.00 (tax incl.)
The BCA Protein Quantification Kit is currently one of the most sensitive protein determination methods. Under alkaline conditions, the protein reduces Cu2+ to Cu+, and Cu+ interacts with the unique BCA Reagent A...
KRISHZYME™ Heparin Factor IIa Assay Kit KRISHZYME™ Heparin Factor IIa Assay Kit

KRISHZYME™ Heparin Factor IIa Assay Kit

Reference: KBBA03S
€0.00 (tax incl.)
Chromogenic assay for testing Heparins (UFH) in purified systems by measurement of Factor IIa inhibition, in compliance with EP Pharmacopoeia. About the kit: - Uses anti-idiotypic antibodies sourced from our vendor...
KRISHZYME™ Heparin Factor Xa Assay Kit - 200 Tests KRISHZYME™ Heparin Factor Xa Assay Kit - 200 Tests

KRISHZYME™ Heparin Factor Xa Assay Kit - 200 Tests

Reference: KBBA04
€0.00 (tax incl.)
Heparin Factor Xa is a chromogenic assay intended for the quantitative determination of unfractioned heparin (UFH) in purified solutions by measurement of factor Xa inhibition activity.
KRISHZYME™ Heparin Factor Xa Assay Kit KRISHZYME™ Heparin Factor Xa Assay Kit

KRISHZYME™ Heparin Factor Xa Assay Kit

Reference: KBBA04S
€0.00 (tax incl.)
Chromogenic assay for testing Heparins (UFH) in purified systems by measurement of Factor Xa inhibition, in compliance with EP Pharmacopoeia. About the kit: - Uses anti-idiotypic antibodies sourced from our vendor...
KRISHZYME™ Enoxaparin Factor IIa Assay Kit KRISHZYME™ Enoxaparin Factor IIa Assay Kit

KRISHZYME™ Enoxaparin Factor IIa Assay Kit

Reference: KBBA03ES
€0.00 (tax incl.)
Chromogenic assay for testing Enoxaparin in purified systems by measurement of factor IIa inhibition, in compliance with pharmacopoeias (EP/BP) and FDA guidelines About the kit: - Uses anti-idiotypic antibodies...
KRISHZYME™ Enoxaparin Factor Xa Assay Kit KRISHZYME™ Enoxaparin Factor Xa Assay Kit

KRISHZYME™ Enoxaparin Factor Xa Assay Kit

Reference: KBBA04ES
€0.00 (tax incl.)
Chromogenic assay for testing Enoxaparin in purified systems by measurement of factor Xa inhibition, in compliance with pharmacopoeias (EP/BP) and FDA guidelines About the kit: - Uses anti-idiotypic antibodies...
KRISHZYME™ Nadroparin Factor IIa Assay Kit KRISHZYME™ Nadroparin Factor IIa Assay Kit

KRISHZYME™ Nadroparin Factor IIa Assay Kit

Reference: KBBA03N
€0.00 (tax incl.)
Nadroparin Factor lla is a chromogenic assay intended for the quantitative determination of Nadroparin in purified&solutions by measurement of factor IIa inhibition activity.
KRISHZYME™ Nadroparin Factor Xa Assay Kit KRISHZYME™ Nadroparin Factor Xa Assay Kit

KRISHZYME™ Nadroparin Factor Xa Assay Kit

Reference: KBBA04N
€0.00 (tax incl.)
Nadroparin Factor Xa is a chromogenic assay intended for the quantitative determination of Nadroparin in purified&solutions by measurement of factor Xa inhibition activity.
KRISHZYME™ Tinzaparin Factor IIa Assay Kit KRISHZYME™ Tinzaparin Factor IIa Assay Kit

KRISHZYME™ Tinzaparin Factor IIa Assay Kit

Reference: KBBA03T
€0.00 (tax incl.)
Tinzaparin Factor lla is a chromogenic assay intended for the quantitative determination of Tinzaparin in purifiedsolutions by measurement of factor IIa inhibition activity.
KRISHZYME™ Tinzaparin Factor Xa Assay Kit KRISHZYME™ Tinzaparin Factor Xa Assay Kit

KRISHZYME™ Tinzaparin Factor Xa Assay Kit

Reference: KBBA04T
€0.00 (tax incl.)
Tinzaparin Factor Xa is a chromogenic assay intended for the quantitative determination of Tinzaparin in purified solutions by measurement of factor Xa inhibition activity.
KRISHZYME™ Hyaluronidase Enzymatic Assay Kit KRISHZYME™ Hyaluronidase Enzymatic Assay Kit

KRISHZYME™ Hyaluronidase Enzymatic Assay Kit

Reference: KBBA05
€0.00 (tax incl.)
Enzymatic Assay for Quantification of Hyaluronidase activity in cell culture supernatant and pharmaceutical preparations Hyaluronidase is a family of enzymes that degrade hyaluronic acid by catalyzing the hydrolysis...
KRISHZYME™ Prekallikrein Activator Assay Kit KRISHZYME™ Prekallikrein Activator Assay Kit

KRISHZYME™ Prekallikrein Activator Assay Kit

Reference: KBBA30EP
€0.00 (tax incl.)
KRISHZYME Plasma Kallikrein Activitor Assay Kit utilizes the ability of active plasma kallikrein to cleave a synthetic pNA-based peptide substrate to release pNA, which can be easily quantified using a microplate...
KRIBIOLISA™ Human IgG4 KRIBIOLISA™ Human IgG4

KRIBIOLISA™ Human IgG4

Reference: KBI1007
€0.00 (tax incl.)
Immunoassay for the quantification of Human IgG in cell culture and biological samples. About the kit: - Uses anti-idiotypic antibodies sourced from our vendor partner in the US, which ensures higher specificity,...
KRIBIOLISA™ E.coli Host Cell DNA Kit KRIBIOLISA™ E.coli Host Cell DNA Kit

KRIBIOLISA™ E.coli Host Cell DNA Kit

Reference: KBBR01
€0.00 (tax incl.)
For the production of biotechnological products, expression of therapeutic proteins in E.coli cells is commonly used. Due to which there is a possibility of DNA contamination from the host cells in the products which...
KRIBIOLISA™ CHO Host Cell DNA Kit KRIBIOLISA™ CHO Host Cell DNA Kit

KRIBIOLISA™ CHO Host Cell DNA Kit

Reference: KBBR02
€0.00 (tax incl.)
Immunoassay for the measurement of HEK Host Cell Proteins. For the production of biotechnological products, expression of therapeutic proteins in CHO cells is commonly used. Due to which there is a possibility of DNA...
KRIBIOLISA™ Insect Cell Host Cell DNA Kit KRIBIOLISA™ Insect Cell Host Cell DNA Kit

KRIBIOLISA™ Insect Cell Host Cell DNA Kit

Reference: KBBR03
€0.00 (tax incl.)
For the production of biotechnological products, expression of therapeutic proteins in insect cells is commonly used. Due to which there is a possibility of DNA contamination from the host cells in the products which...
KRIBIOLISA™ Protein L Ligand Detection Kit KRIBIOLISA™ Protein L Ligand Detection Kit

KRIBIOLISA™ Protein L Ligand Detection Kit

Reference: KBBP50
€0.00 (tax incl.)
Enzyme Immunoassay for the Quantitative determination of Protein L Ligand Detection from medium containing immunoglobulin (Ig) or Ig-fragments
TBNK Flow Cytometry Assay Kit TBNK Flow Cytometry Assay Kit

TBNK Flow Cytometry Assay Kit

Reference: 137-00020
€0.00 (tax incl.)
The RayBio® Human TBNK Flow Cytometry Kit is designed to determine the percentages and absolute counts of mature human lymphocyte subsets in peripheral whole blood (WB). The subsets include T lymphocytes (CD3⁺),...
TBMNK Flow Cytometry Assay Kit TBMNK Flow Cytometry Assay Kit

TBMNK Flow Cytometry Assay Kit

Reference: 137-00021
€0.00 (tax incl.)
The RayBio® Human TBMNK Flow Cytometry Kit is designed to determine the percentages of mature human lymphocyte and monocyte subsets in peripheral whole blood (WB).
RayBio® Annexin V Apoptosis Kit RayBio® Annexin V Apoptosis Kit

RayBio® Annexin V Apoptosis Kit

Reference: 137-08010
€0.00 (tax incl.)
The RayBiotech Annexin V Detection Kit is a sensitive assay for detection of cell apoptosis by flow cytometry.

Menu

Settings

Please sign in first.

Sign in