Category: Research kits

Filter By
Brand: Cayman Chemical Brand: FineTest Brand: Genetex Brand: Raybiotech Brand: Signalchem Brand: Vazyme Clear all
Modified PKA Substrate Modified PKA Substrate

Modified PKA Substrate

Reference: C01-58B
€0.00 (tax incl.)
The modified PKA Substrate peptide sequence (modified-CGRTGRRNSI-amide) is based on the cAMP-dependent protein kinase inhibitor alpha (amino acid 15-23).
p38 Substrate p38 Substrate

p38 Substrate

Reference: P03-58
€0.00 (tax incl.)
The synthetic peptide (IPTTPITTTYFFFKKK) contains serine/threonine protein kinase phosphorylation sites and is routinely evaluated as a substrate for p38 family kinases.
PKA Substrate PKA Substrate

PKA Substrate

Reference: C01-58
€0.00 (tax incl.)
The PKA sub peptide sequence (CGRTGRRNSI-amide) is based on the cAMP-dependent protein kinase inhibitor alpha (amino acid 15-23).
PLpro FRET Substrate PLpro FRET Substrate

PLpro FRET Substrate

Reference: PL01-58-500
€0.00 (tax incl.)
Synthetic FRET peptide substrate specific for PLpro.
PLpro FRET Substrate PLpro FRET Substrate

PLpro FRET Substrate

Reference: PL01-58-1000
€0.00 (tax incl.)
Synthetic FRET peptide substrate specific for PLpro.
PP1/PP2A Substrate PP1/PP2A Substrate

PP1/PP2A Substrate

Reference: P50-58-1000
€0.00 (tax incl.)
The PP1/PP2A Substrate peptide [GRPRTS(p)SFAEG] is derived from human GSK3b (glycogen synthase kinase-3 beta) (amino acids 3-13) and is suitable as PP1 and PP2A substrate.
PP2B Substrate PP2B Substrate

PP2B Substrate

Reference: P51-58-1000
€0.00 (tax incl.)
The PP2B Substrate peptide [DLDVPIPGRFDRRV(p)SVAAE] is derived from bovine PRKAR2A (cAMP-dependent protein kinase type II-alpha regulatory subunit) (amino acids 82-100) and is suitable as PP2B substrate.
RSK Substrate RSK Substrate

RSK Substrate

Reference: S06-58
€0.00 (tax incl.)
The RSK sub peptide sequence (KRRRLSSLRA) is based on human 40S ribosomal protein S6 (amino acid 230-239).
S6K Substrate S6K Substrate

S6K Substrate

Reference: S05-58
€0.00 (tax incl.)
The S6K sub peptide sequence (KRRRLASLR) is based on human 40S ribosomal protein S6 (amino acid 230-238).
SRC Substrate SRC Substrate

SRC Substrate

Reference: S30-58
€0.00 (tax incl.)
The SRC sub peptide sequence (KVEKIGEGTYGVVYK-amide) is based on the p34cdc2 (amino acid 6-20).
Tyrosine Kinase Substrate-3 Tyrosine Kinase Substrate-3

Tyrosine Kinase Substrate-3

Reference: T71-58
€0.00 (tax incl.)
The synthetic peptide Tyrosine Kinase Substrate-3 (RRLIEDAEYAARG) is derived from human SRC (amino acid 412-422) and considered to be a generic substrate for various protein tyrosine kinases.
DUB Substrate I DUB Substrate I

DUB Substrate I

Reference: U06-57-10
€0.00 (tax incl.)
The ubiquitin-based proluciferin substrate is based on the C-terminal derivative of Ubiquitin.
DUB Substrate II DUB Substrate II

DUB Substrate II

Reference: S293-57-10
€0.00 (tax incl.)
The SUMO1-based proluciferin substrate is based on the C-terminal derivative of SUMO1.
DUB Substrate III DUB Substrate III

DUB Substrate III

Reference: N263-57-10
€0.00 (tax incl.)
The NEDD8-based proluciferin substrate is based on the C-terminal derivative of NEDD8.
DNMT Substrate-1 DNMT Substrate-1

DNMT Substrate-1

Reference: D53-58-05
€0.00 (tax incl.)
The synthetic double-stranded oligonucleotide (Sense: 5’- GATCCGACGACGACGCGCGCGCGACGACGAGATC; Anti-sense: 5’- GATCTCGTCGTCGCGCGCGCGTCGTCGTCGGAC) is used as a substrate for DNA methyltransferase 3A (DNMT3A).
METTL3/METTL14 Substrate METTL3/METTL14 Substrate

METTL3/METTL14 Substrate

Reference: M323-58-025
€0.00 (tax incl.)
The synthetic single-stranded 27 base’s oligo ribo-nucleotide is used as a substrate for assay of methyltransferase METTL3/METTL14 complex.
Poly (1:1 dI, dC) Acid Poly (1:1 dI, dC) Acid

Poly (1:1 dI, dC) Acid

Reference: P62-58-25
€0.00 (tax incl.)
The synthetic poly (deoxyinosinic-deoxycytidylic) acid sodium salt – double-stranded polymer (synthesized as 1:1 ratio) is used as a substrate for DNA methyltransferases.
PI(3)P PI(3)P

PI(3)P

Reference: P421-59-05
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(3)P PI(3)P

PI(3)P

Reference: P421-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(3)P:PS PI(3)P:PS

PI(3)P:PS

Reference: P426-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(3)P:PS PI(3)P:PS

PI(3)P:PS

Reference: P426-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4)P PI(4)P

PI(4)P

Reference: P422-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4)P PI(4)P

PI(4)P

Reference: P422-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4)P:PS PI(4)P:PS

PI(4)P:PS

Reference: P427-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4)P:PS PI(4)P:PS

PI(4)P:PS

Reference: P427-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4,5)P2 PI(4,5)P2

PI(4,5)P2

Reference: P424-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4,5)P2 PI(4,5)P2

PI(4,5)P2

Reference: P424-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4,5)P2:PS PI(4,5)P2:PS

PI(4,5)P2:PS

Reference: P429-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4,5)P2:PS PI(4,5)P2:PS

PI(4,5)P2:PS

Reference: P429-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(5)P PI(5)P

PI(5)P

Reference: P423-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(5)P PI(5)P

PI(5)P

Reference: P423-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(5)P:PS PI(5)P:PS

PI(5)P:PS

Reference: P428-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(5)P:PS PI(5)P:PS

PI(5)P:PS

Reference: P428-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI:PS PI:PS

PI:PS

Reference: P425-59B-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI:PS PI:PS

PI:PS

Reference: P425-59B-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
D-Fructose-6-phosphate D-Fructose-6-phosphate

D-Fructose-6-phosphate

Reference: F520-59-10
€0.00 (tax incl.)
D-Fructose-6-phosphate (sodium salt hydrate) is supplied as a crystalline solid.
D-Glucose-6-phosphate D-Glucose-6-phosphate

D-Glucose-6-phosphate

Reference: F521-59-10 mg
€0.00 (tax incl.)
D-glucose-6-phosphate (sodium salt) is supplied as a crystalline solid.
C-Series Detection Buffer C&D C-Series Detection Buffer C&D

C-Series Detection Buffer C&D

Reference: 0103004-D2
€0.00 (tax incl.)
Detection Buffer C&D for membrane-based Antibody Array Kits (8 array supply).
20X Wash Buffers I and II 20X Wash Buffers I and II

20X Wash Buffers I and II

Reference: 0103004-W
€0.00 (tax incl.)
20X Wash Buffer I and II for Antibody Array Kits, (20 ml each)
CCK-8 Cell Counting Kit CCK-8 Cell Counting Kit

CCK-8 Cell Counting Kit

Reference: A311-01
€0.00 (tax incl.)
CCK-8 Cell Counting Kit, referred to as CCK-8 kit, is dependent on WST-8 (2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5- (2,4-Disulfobenzene)-2H-tetrazole monosodium salt) is a fast, highly sensitive,...
CCK-8 Cell Counting Kit CCK-8 Cell Counting Kit

CCK-8 Cell Counting Kit

Reference: A311-02
€0.00 (tax incl.)
CCK-8 Cell Counting Kit, referred to as CCK-8 kit, is dependent on WST-8 (2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5- (2,4-Disulfobenzene)-2H-tetrazole monosodium salt) is a fast, highly sensitive,...
Dual Luciferase Reporter Assay Kit Dual Luciferase Reporter Assay Kit

Dual Luciferase Reporter Assay Kit

Reference: DL101-01
€0.00 (tax incl.)
The Dual Luciferase Reporter Assay Kit is used to detect the fluorescence intensity of the Luciferin substrate after the reporter plasmid is transfected into the cells, so as to reflect the expression of luciferase...
Add&Read Human IgG Kit Add&Read Human IgG Kit

Add&Read Human IgG Kit

Reference: DD2101-01
€0.00 (tax incl.)
Add&ReadTM Human IgG Kit can be used to detect the concentration of Human IgG (hlgG) in the cell supernatant or after purification. There are two antibodies that recognize hIgG in the kit, namely: the antibody that...
Add&Read Human IgG Kit Add&Read Human IgG Kit

Add&Read Human IgG Kit

Reference: DD2101-02
€0.00 (tax incl.)
Add&ReadTM Human IgG Kit can be used to detect the concentration of Human IgG (hlgG) in the cell supernatant or after purification. There are two antibodies that recognize hIgG in the kit, namely: the antibody that...
Add&Read Human Fc Kit Add&Read Human Fc Kit

Add&Read Human Fc Kit

Reference: DD2102-01
€0.00 (tax incl.)
Add&ReadTM Human Fc Kit can be used to detect the concentration of Human IgG or hFc-fusion protein (hFc-fusion protien) in the cell supernatant or after purification. There is an antibody in the kit that recognizes...
Add&Read Human Fc Kit Add&Read Human Fc Kit

Add&Read Human Fc Kit

Reference: DD2102-02
€0.00 (tax incl.)
Add&ReadTM Human Fc Kit can be used to detect the concentration of Human IgG or hFc-fusion protein (hFc-fusion protien) in the cell supernatant or after purification. There is an antibody in the kit that recognizes...
BCA Protein Quantification Kit BCA Protein Quantification Kit

BCA Protein Quantification Kit

Reference: E112-01
€0.00 (tax incl.)
The BCA Protein Quantification Kit is currently one of the most sensitive protein determination methods. Under alkaline conditions, the protein reduces Cu2+ to Cu+, and Cu+ interacts with the unique BCA Reagent A...
BCA Protein Quantification Kit BCA Protein Quantification Kit

BCA Protein Quantification Kit

Reference: E112-02
€0.00 (tax incl.)
The BCA Protein Quantification Kit is currently one of the most sensitive protein determination methods. Under alkaline conditions, the protein reduces Cu2+ to Cu+, and Cu+ interacts with the unique BCA Reagent A...

Menu

Settings

Please sign in first.

Sign in