Category: Research kits

Reference: C01-58B
€0.00 (tax incl.)
The modified PKA Substrate peptide sequence (modified-CGRTGRRNSI-amide) is based on the cAMP-dependent protein kinase inhibitor alpha (amino acid 15-23).
Reference: P03-58
€0.00 (tax incl.)
The synthetic peptide (IPTTPITTTYFFFKKK) contains serine/threonine protein kinase phosphorylation sites and is routinely evaluated as a substrate for p38 family kinases.
Reference: C01-58
€0.00 (tax incl.)
The PKA sub peptide sequence (CGRTGRRNSI-amide) is based on the cAMP-dependent protein kinase inhibitor alpha (amino acid 15-23).
Reference: PL01-58-500
€0.00 (tax incl.)
Synthetic FRET peptide substrate specific for PLpro.
Reference: PL01-58-1000
€0.00 (tax incl.)
Synthetic FRET peptide substrate specific for PLpro.
Reference: P50-58-1000
€0.00 (tax incl.)
The PP1/PP2A Substrate peptide [GRPRTS(p)SFAEG] is derived from human GSK3b (glycogen synthase kinase-3 beta) (amino acids 3-13) and is suitable as PP1 and PP2A substrate.
Reference: P51-58-1000
€0.00 (tax incl.)
The PP2B Substrate peptide [DLDVPIPGRFDRRV(p)SVAAE] is derived from bovine PRKAR2A (cAMP-dependent protein kinase type II-alpha regulatory subunit) (amino acids 82-100) and is suitable as PP2B substrate.
Reference: S06-58
€0.00 (tax incl.)
The RSK sub peptide sequence (KRRRLSSLRA) is based on human 40S ribosomal protein S6 (amino acid 230-239).
Reference: S05-58
€0.00 (tax incl.)
The S6K sub peptide sequence (KRRRLASLR) is based on human 40S ribosomal protein S6 (amino acid 230-238).
Reference: S30-58
€0.00 (tax incl.)
The SRC sub peptide sequence (KVEKIGEGTYGVVYK-amide) is based on the p34cdc2 (amino acid 6-20).
Reference: T71-58
€0.00 (tax incl.)
The synthetic peptide Tyrosine Kinase Substrate-3 (RRLIEDAEYAARG) is derived from human SRC (amino acid 412-422) and considered to be a generic substrate for various protein tyrosine kinases.
Reference: U06-57-10
€0.00 (tax incl.)
The ubiquitin-based proluciferin substrate is based on the C-terminal derivative of Ubiquitin.
Reference: S293-57-10
€0.00 (tax incl.)
The SUMO1-based proluciferin substrate is based on the C-terminal derivative of SUMO1.
Reference: N263-57-10
€0.00 (tax incl.)
The NEDD8-based proluciferin substrate is based on the C-terminal derivative of NEDD8.
Reference: D53-58-05
€0.00 (tax incl.)
The synthetic double-stranded oligonucleotide (Sense: 5’- GATCCGACGACGACGCGCGCGCGACGACGAGATC; Anti-sense: 5’- GATCTCGTCGTCGCGCGCGCGTCGTCGTCGGAC) is used as a substrate for DNA methyltransferase 3A (DNMT3A).
Reference: M323-58-025
€0.00 (tax incl.)
The synthetic single-stranded 27 base’s oligo ribo-nucleotide is used as a substrate for assay of methyltransferase METTL3/METTL14 complex.
Reference: P62-58-25
€0.00 (tax incl.)
The synthetic poly (deoxyinosinic-deoxycytidylic) acid sodium salt – double-stranded polymer (synthesized as 1:1 ratio) is used as a substrate for DNA methyltransferases.
Reference: P421-59-05
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P421-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P426-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P426-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P422-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P422-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P427-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P427-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P424-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P424-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P429-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P429-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P423-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P423-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P428-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P428-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P425-59B-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P425-59B-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: F520-59-10
€0.00 (tax incl.)
D-Fructose-6-phosphate (sodium salt hydrate) is supplied as a crystalline solid.
Reference: F521-59-10 mg
€0.00 (tax incl.)
D-glucose-6-phosphate (sodium salt) is supplied as a crystalline solid.
Reference: KBBA03S
€0.00 (tax incl.)
Chromogenic assay for testing Heparins (UFH) in purified systems by measurement of Factor IIa inhibition, in compliance with EP Pharmacopoeia. About the kit: - Uses anti-idiotypic antibodies sourced from our vendor...
Reference: KBBA04
€0.00 (tax incl.)
Heparin Factor Xa is a chromogenic assay intended for the quantitative determination of unfractioned heparin (UFH) in purified solutions by measurement of factor Xa inhibition activity.
Reference: KBBA04S
€0.00 (tax incl.)
Chromogenic assay for testing Heparins (UFH) in purified systems by measurement of Factor Xa inhibition, in compliance with EP Pharmacopoeia. About the kit: - Uses anti-idiotypic antibodies sourced from our vendor...
Reference: KBBA03ES
€0.00 (tax incl.)
Chromogenic assay for testing Enoxaparin in purified systems by measurement of factor IIa inhibition, in compliance with pharmacopoeias (EP/BP) and FDA guidelines About the kit: - Uses anti-idiotypic antibodies...
Reference: KBBA04ES
€0.00 (tax incl.)
Chromogenic assay for testing Enoxaparin in purified systems by measurement of factor Xa inhibition, in compliance with pharmacopoeias (EP/BP) and FDA guidelines About the kit: - Uses anti-idiotypic antibodies...
Reference: KBBA03N
€0.00 (tax incl.)
Nadroparin Factor lla is a chromogenic assay intended for the quantitative determination of Nadroparin in purified&solutions by measurement of factor IIa inhibition activity.
Reference: KBBA04N
€0.00 (tax incl.)
Nadroparin Factor Xa is a chromogenic assay intended for the quantitative determination of Nadroparin in purified&solutions by measurement of factor Xa inhibition activity.
Reference: KBBA03T
€0.00 (tax incl.)
Tinzaparin Factor lla is a chromogenic assay intended for the quantitative determination of Tinzaparin in purifiedsolutions by measurement of factor IIa inhibition activity.
Reference: KBBA04T
€0.00 (tax incl.)
Tinzaparin Factor Xa is a chromogenic assay intended for the quantitative determination of Tinzaparin in purified solutions by measurement of factor Xa inhibition activity.
Reference: KBBA05
€0.00 (tax incl.)
Enzymatic Assay for Quantification of Hyaluronidase activity in cell culture supernatant and pharmaceutical preparations Hyaluronidase is a family of enzymes that degrade hyaluronic acid by catalyzing the hydrolysis...
Reference: KBBA30EP
€0.00 (tax incl.)
KRISHZYME Plasma Kallikrein Activitor Assay Kit utilizes the ability of active plasma kallikrein to cleave a synthetic pNA-based peptide substrate to release pNA, which can be easily quantified using a microplate...
Reference: KBI1007
€0.00 (tax incl.)
Immunoassay for the quantification of Human IgG in cell culture and biological samples. About the kit: - Uses anti-idiotypic antibodies sourced from our vendor partner in the US, which ensures higher specificity,...
Reference: KBBR01
€0.00 (tax incl.)
For the production of biotechnological products, expression of therapeutic proteins in E.coli cells is commonly used. Due to which there is a possibility of DNA contamination from the host cells in the products which...
Reference: KBBR02
€0.00 (tax incl.)
Immunoassay for the measurement of HEK Host Cell Proteins. For the production of biotechnological products, expression of therapeutic proteins in CHO cells is commonly used. Due to which there is a possibility of DNA...
Reference: KBBR03
€0.00 (tax incl.)
For the production of biotechnological products, expression of therapeutic proteins in insect cells is commonly used. Due to which there is a possibility of DNA contamination from the host cells in the products which...
Reference: KBBP50
€0.00 (tax incl.)
Enzyme Immunoassay for the Quantitative determination of Protein L Ligand Detection from medium containing immunoglobulin (Ig) or Ig-fragments
Reference: AR1160
€0.00 (tax incl.)
Cell Counting Kit-8 (CCK-8), For quantitation of viable cell number in proliferation and cytotoxicity assays

Menu

Settings