Category: Research kits

Reference: L51-39-500
€0.00 (tax incl.)
10x stock solution used for assaying protein kinase activity of PKC family members. Vortex or sonicate prior to use.
Reference: CL01-58-500
€0.00 (tax incl.)
Synthetic FRET peptide substrate specific for 3CLpro.
Reference: CL01-58-1000
€0.00 (tax incl.)
Synthetic FRET peptide substrate specific for 3CLpro.
Reference: A05-58
€0.00 (tax incl.)
The AKT (PKB) Substrate peptide sequence (CKRPRAASFAE) is based on the N-terminus of GSK3.
Reference: A08-58
€0.00 (tax incl.)
The AKT (SGK) Substrate peptide sequence (RPRAATF) is based on the N-terminus of GSK3.
Reference: C08-58
€0.00 (tax incl.)
The synthetic peptide (RRRADDSDDDDD) contains serine protein kinase phosphorylation site surrounded by acidic residues and is high selectively evaluated as a substrate for CK2 family kinases.
Reference: G50-58
€0.00 (tax incl.)
The GSK3 sub peptide sequence (YRRAAVPPSPSLSRHSSPHQ(pS)EDEEE) is based on human muscle glycogen synthase 1 (amino acid 636-661).
Reference: E27-58
€0.00 (tax incl.)
The HER2 Substrate synthetic peptide [AAEEIYAARRG] is routinely evaluated as a substrate for HER2.
Reference: A05-58B
€0.00 (tax incl.)
The Modified AKT Substrate peptide sequence (modified-CKRPRAASFAE) is based on the N-terminus of GSK3.
Reference: A05-58C
€0.00 (tax incl.)
The Modified AKT Substrate II peptide sequence (modified-CKRPRAASFAE) is based on the N-terminus of GSK3.
Reference: A16-58B
€0.00 (tax incl.)
The Axltide peptide sequence (CKKSRGDYMTMQIG) is based on the mouse Insulin receptor substrate 1 (amino acid 979-989).
Reference: C01-58B
€0.00 (tax incl.)
The modified PKA Substrate peptide sequence (modified-CGRTGRRNSI-amide) is based on the cAMP-dependent protein kinase inhibitor alpha (amino acid 15-23).
Reference: P03-58
€0.00 (tax incl.)
The synthetic peptide (IPTTPITTTYFFFKKK) contains serine/threonine protein kinase phosphorylation sites and is routinely evaluated as a substrate for p38 family kinases.
Reference: C01-58
€0.00 (tax incl.)
The PKA sub peptide sequence (CGRTGRRNSI-amide) is based on the cAMP-dependent protein kinase inhibitor alpha (amino acid 15-23).
Reference: PL01-58-500
€0.00 (tax incl.)
Synthetic FRET peptide substrate specific for PLpro.
Reference: PL01-58-1000
€0.00 (tax incl.)
Synthetic FRET peptide substrate specific for PLpro.
Reference: P50-58-1000
€0.00 (tax incl.)
The PP1/PP2A Substrate peptide [GRPRTS(p)SFAEG] is derived from human GSK3b (glycogen synthase kinase-3 beta) (amino acids 3-13) and is suitable as PP1 and PP2A substrate.
Reference: P51-58-1000
€0.00 (tax incl.)
The PP2B Substrate peptide [DLDVPIPGRFDRRV(p)SVAAE] is derived from bovine PRKAR2A (cAMP-dependent protein kinase type II-alpha regulatory subunit) (amino acids 82-100) and is suitable as PP2B substrate.
Reference: S06-58
€0.00 (tax incl.)
The RSK sub peptide sequence (KRRRLSSLRA) is based on human 40S ribosomal protein S6 (amino acid 230-239).
Reference: S05-58
€0.00 (tax incl.)
The S6K sub peptide sequence (KRRRLASLR) is based on human 40S ribosomal protein S6 (amino acid 230-238).
Reference: S30-58
€0.00 (tax incl.)
The SRC sub peptide sequence (KVEKIGEGTYGVVYK-amide) is based on the p34cdc2 (amino acid 6-20).
Reference: T71-58
€0.00 (tax incl.)
The synthetic peptide Tyrosine Kinase Substrate-3 (RRLIEDAEYAARG) is derived from human SRC (amino acid 412-422) and considered to be a generic substrate for various protein tyrosine kinases.
Reference: U06-57-10
€0.00 (tax incl.)
The ubiquitin-based proluciferin substrate is based on the C-terminal derivative of Ubiquitin.
Reference: S293-57-10
€0.00 (tax incl.)
The SUMO1-based proluciferin substrate is based on the C-terminal derivative of SUMO1.
Reference: N263-57-10
€0.00 (tax incl.)
The NEDD8-based proluciferin substrate is based on the C-terminal derivative of NEDD8.
Reference: D53-58-05
€0.00 (tax incl.)
The synthetic double-stranded oligonucleotide (Sense: 5’- GATCCGACGACGACGCGCGCGCGACGACGAGATC; Anti-sense: 5’- GATCTCGTCGTCGCGCGCGCGTCGTCGTCGGAC) is used as a substrate for DNA methyltransferase 3A (DNMT3A).
Reference: M323-58-025
€0.00 (tax incl.)
The synthetic single-stranded 27 base’s oligo ribo-nucleotide is used as a substrate for assay of methyltransferase METTL3/METTL14 complex.
Reference: P62-58-25
€0.00 (tax incl.)
The synthetic poly (deoxyinosinic-deoxycytidylic) acid sodium salt – double-stranded polymer (synthesized as 1:1 ratio) is used as a substrate for DNA methyltransferases.
Reference: P421-59-05
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P421-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P426-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P426-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P422-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P422-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P427-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P427-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P424-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P424-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P429-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P429-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P423-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P423-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P428-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P428-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P425-59B-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P425-59B-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: F520-59-10
€0.00 (tax incl.)
D-Fructose-6-phosphate (sodium salt hydrate) is supplied as a crystalline solid.
Reference: F521-59-10 mg
€0.00 (tax incl.)
D-glucose-6-phosphate (sodium salt) is supplied as a crystalline solid.
Reference: ARG81188
€0.00 (tax incl.)
Nitric oxide is a reactive free radical which acts as a biologic mediator in several processes, including neurotransmission and antimicrobial and antitumoral activities. Nitric oxide is synthesized from L-arginine by...
Reference: ARG81239
€0.00 (tax incl.)
There are at least four distinct but related alkaline phosphatases: intestinal, placental, placental-like, and liver/bone/kidney (tissue non-specific). The first three are located together on chromosome 2, while the...
Reference: ARG81296
€0.00 (tax incl.)
There are at least four distinct but related alkaline phosphatases: intestinal, placental, placental-like, and liver/bone/kidney (tissue non-specific). The first three are located together on chromosome 2, while the...
Reference: ARG81297
€0.00 (tax incl.)
Glutamic-oxaloacetic transaminase is a pyridoxal phosphate-dependent enzyme which exists in cytoplasmic and mitochondrial forms, GOT1 and GOT2, respectively. GOT plays a role in amino acid metabolism and the urea and...
Reference: ARG81298
€0.00 (tax incl.)
This gene encodes cytosolic alanine aminotransaminase 1 (ALT1); also known as glutamate-pyruvate transaminase 1. This enzyme catalyzes the reversible transamination between alanine and 2-oxoglutarate to generate...
Reference: ARG81299
€0.00 (tax incl.)
The content of DNA is changed with the process of cell cycle. And the DNA can be stained by fluorescent dye to measure its intensity by flow cytometry to monitor the cell cycle distribution in G1, S, GS/M phase and as...
Reference: ARG81352
€0.00 (tax incl.)
The protein encoded by this gene catalyzes the conversion of L-lactate and NAD to pyruvate and NADH in the final step of anaerobic glycolysis. The protein is found predominantly in muscle tissue and belongs to the...
Reference: ARG81353
€0.00 (tax incl.)
The protein encoded by this gene binds copper and zinc ions and is one of two isozymes responsible for destroying free superoxide radicals in the body. The encoded isozyme is a soluble cytoplasmic protein, acting as a...

Menu

Settings