Category: Research kits

Reference: L51-39-500
€0.00 (tax incl.)
10x stock solution used for assaying protein kinase activity of PKC family members. Vortex or sonicate prior to use.
Reference: CL01-58-500
€0.00 (tax incl.)
Synthetic FRET peptide substrate specific for 3CLpro.
Reference: CL01-58-1000
€0.00 (tax incl.)
Synthetic FRET peptide substrate specific for 3CLpro.
Reference: A05-58
€0.00 (tax incl.)
The AKT (PKB) Substrate peptide sequence (CKRPRAASFAE) is based on the N-terminus of GSK3.
Reference: A08-58
€0.00 (tax incl.)
The AKT (SGK) Substrate peptide sequence (RPRAATF) is based on the N-terminus of GSK3.
Reference: C08-58
€0.00 (tax incl.)
The synthetic peptide (RRRADDSDDDDD) contains serine protein kinase phosphorylation site surrounded by acidic residues and is high selectively evaluated as a substrate for CK2 family kinases.
Reference: G50-58
€0.00 (tax incl.)
The GSK3 sub peptide sequence (YRRAAVPPSPSLSRHSSPHQ(pS)EDEEE) is based on human muscle glycogen synthase 1 (amino acid 636-661).
Reference: E27-58
€0.00 (tax incl.)
The HER2 Substrate synthetic peptide [AAEEIYAARRG] is routinely evaluated as a substrate for HER2.
Reference: A05-58B
€0.00 (tax incl.)
The Modified AKT Substrate peptide sequence (modified-CKRPRAASFAE) is based on the N-terminus of GSK3.
Reference: A05-58C
€0.00 (tax incl.)
The Modified AKT Substrate II peptide sequence (modified-CKRPRAASFAE) is based on the N-terminus of GSK3.
Reference: A16-58B
€0.00 (tax incl.)
The Axltide peptide sequence (CKKSRGDYMTMQIG) is based on the mouse Insulin receptor substrate 1 (amino acid 979-989).
Reference: C01-58B
€0.00 (tax incl.)
The modified PKA Substrate peptide sequence (modified-CGRTGRRNSI-amide) is based on the cAMP-dependent protein kinase inhibitor alpha (amino acid 15-23).
Reference: P03-58
€0.00 (tax incl.)
The synthetic peptide (IPTTPITTTYFFFKKK) contains serine/threonine protein kinase phosphorylation sites and is routinely evaluated as a substrate for p38 family kinases.
Reference: C01-58
€0.00 (tax incl.)
The PKA sub peptide sequence (CGRTGRRNSI-amide) is based on the cAMP-dependent protein kinase inhibitor alpha (amino acid 15-23).
Reference: PL01-58-500
€0.00 (tax incl.)
Synthetic FRET peptide substrate specific for PLpro.
Reference: PL01-58-1000
€0.00 (tax incl.)
Synthetic FRET peptide substrate specific for PLpro.
Reference: P50-58-1000
€0.00 (tax incl.)
The PP1/PP2A Substrate peptide [GRPRTS(p)SFAEG] is derived from human GSK3b (glycogen synthase kinase-3 beta) (amino acids 3-13) and is suitable as PP1 and PP2A substrate.
Reference: P51-58-1000
€0.00 (tax incl.)
The PP2B Substrate peptide [DLDVPIPGRFDRRV(p)SVAAE] is derived from bovine PRKAR2A (cAMP-dependent protein kinase type II-alpha regulatory subunit) (amino acids 82-100) and is suitable as PP2B substrate.
Reference: S06-58
€0.00 (tax incl.)
The RSK sub peptide sequence (KRRRLSSLRA) is based on human 40S ribosomal protein S6 (amino acid 230-239).
Reference: S05-58
€0.00 (tax incl.)
The S6K sub peptide sequence (KRRRLASLR) is based on human 40S ribosomal protein S6 (amino acid 230-238).
Reference: S30-58
€0.00 (tax incl.)
The SRC sub peptide sequence (KVEKIGEGTYGVVYK-amide) is based on the p34cdc2 (amino acid 6-20).
Reference: T71-58
€0.00 (tax incl.)
The synthetic peptide Tyrosine Kinase Substrate-3 (RRLIEDAEYAARG) is derived from human SRC (amino acid 412-422) and considered to be a generic substrate for various protein tyrosine kinases.
Reference: U06-57-10
€0.00 (tax incl.)
The ubiquitin-based proluciferin substrate is based on the C-terminal derivative of Ubiquitin.
Reference: S293-57-10
€0.00 (tax incl.)
The SUMO1-based proluciferin substrate is based on the C-terminal derivative of SUMO1.
Reference: N263-57-10
€0.00 (tax incl.)
The NEDD8-based proluciferin substrate is based on the C-terminal derivative of NEDD8.
Reference: D53-58-05
€0.00 (tax incl.)
The synthetic double-stranded oligonucleotide (Sense: 5’- GATCCGACGACGACGCGCGCGCGACGACGAGATC; Anti-sense: 5’- GATCTCGTCGTCGCGCGCGCGTCGTCGTCGGAC) is used as a substrate for DNA methyltransferase 3A (DNMT3A).
Reference: M323-58-025
€0.00 (tax incl.)
The synthetic single-stranded 27 base’s oligo ribo-nucleotide is used as a substrate for assay of methyltransferase METTL3/METTL14 complex.
Reference: P62-58-25
€0.00 (tax incl.)
The synthetic poly (deoxyinosinic-deoxycytidylic) acid sodium salt – double-stranded polymer (synthesized as 1:1 ratio) is used as a substrate for DNA methyltransferases.
Reference: P421-59-05
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P421-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P426-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P426-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P422-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P422-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P427-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P427-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P424-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P424-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P429-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P429-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P423-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P423-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P428-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P428-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P425-59B-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P425-59B-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: F520-59-10
€0.00 (tax incl.)
D-Fructose-6-phosphate (sodium salt hydrate) is supplied as a crystalline solid.
Reference: F521-59-10 mg
€0.00 (tax incl.)
D-glucose-6-phosphate (sodium salt) is supplied as a crystalline solid.
Reference: AS04 051
€0.00 (tax incl.)
This kit allows quantitation of major photosynthetic proteins: Rubisco, PsaC (PSI) and PsbA (PSII) as well as determination of PSI/PSII ratios using the western blot technique. The kit contains following global...
Reference: AS09 409
€0.00 (tax incl.)
The Rubisco quantitation kit is suitable for quantitation of Rubisco in plant and algal samples using quantitative immunoblotting. It contains anti-RbcL antibody, Rubisco protein standard and the Protein Extraction...
Reference: AS20 4458
€0.00 (tax incl.)
Papain (EC=3.4.22.2) is a cysteine protease which belongs to peptidase C1 family. Can cause an allergic reaction in humans. Alternative names: Papaya proteinase I, allergen= Car p 1.
Reference: AS20 4459
€0.00 (tax incl.)
Papain (EC=3.4.22.2) is a cysteine protease which belongs to peptidase C1 family. Can cause an allergic reaction in humans. Alternative names: Papaya proteinase I, allergen= Car p 1.
Reference: AS05 070
€0.00 (tax incl.)
This kit contains antibodies to the following 5 proteins and 4 protein standards for their quantification. It also includes a matching secondary antibody and an ECL detection reagent.Rubisco - universal and absolutely...
Reference: AS15 3074-set
€0.00 (tax incl.)
This kit allows you to test a suitable matching secondary antibody and the best ECL detection reagent that best suits your experiment.This kit contains the following products_Primary antibodyChoos your primary...
Reference: AS16 ECL-N
€0.00 (tax incl.)
AgriseraECL Bright for Western Blot detection is a high quality substrate for detection of horseradish peroxidase enzyme activity at low pico to mid femtogram levels. It's a ready to use 2 component system with low...
Reference: AS16 ECL-S
€0.00 (tax incl.)
AgriseraECL SuperBright for Western Blot detection is a high quality substrate for detection of horseradish peroxidase enzyme activity at extreme low femtogram levels, offering low background and superior signal to...
Reference: AS16 ECL-S-N
€0.00 (tax incl.)
Agrisera ECL kit (Bright/SuperBright) is a Western Blot detection kit, that combines two chemiluminescent reagents with different detetion range for visualization of horseradish peroxidase enzyme activity.It is a...
Reference: AS18 ELISA-ECL
€0.00 (tax incl.)
AgriseraELISA SuperBright is specially formulated for HRP microwell and ELISA system detection. It is a high quality substrate for detection of horseradish peroxidase enzyme activity at true extreme low femtogram...
Reference: AG-44B-0002-KI01
€0.00 (tax incl.)
Induces apoptosis in a concentration range of 5-50ng/ml in the presence of 1µg/ml of TNF Ligands Enhancer (Prod. No. AG-35B-0001).
Reference: AG-44B-0004-KI01
€0.00 (tax incl.)
TRAIL-R1, -R2, -R3 and -R4 are receptors for the cytotoxic ligand TRAIL. When signaling through TRAIL-R1 and -R2, the adapter molecule FADD recruits caspase-8 to the activated receptor. The resulting death-inducing...
Reference: AG-44B-0006-KI01
€0.00 (tax incl.)
IDO1 is a heme-containing enzyme that catalyzes the first and rate-limiting step in the main pathway of human tryptophan catabolism, the kynurenine pathway, causing depletion of tryptophan which can lead to halted...
Reference: AG-44B-2000-KI01
€0.00 (tax incl.)
The Asc (AL177) Antibody + Blocking Peptide Set contains one vial each of the anti-Asc, pAb (AL177) (Prod. No. AG-25B-0006) and the Asc Antibody (AL177) Blocking Peptide (Prod. No. AG-37B-0001). Both compounds are...

Menu

Settings