Category: Research kits

Filter By
Brand: Abclonal Brand: Agrisera Brand: Arigo Biolaboratoires Brand: Biovendor Brand: Signalchem Brand: Vazyme Clear all
PKC Lipid Activator, 10x PKC Lipid Activator, 10x

PKC Lipid Activator, 10x

Reference: L51-39-500
€0.00 (tax incl.)
10x stock solution used for assaying protein kinase activity of PKC family members. Vortex or sonicate prior to use.
3CLpro FRET Substrate 3CLpro FRET Substrate

3CLpro FRET Substrate

Reference: CL01-58-500
€0.00 (tax incl.)
Synthetic FRET peptide substrate specific for 3CLpro.
3CLpro FRET Substrate 3CLpro FRET Substrate

3CLpro FRET Substrate

Reference: CL01-58-1000
€0.00 (tax incl.)
Synthetic FRET peptide substrate specific for 3CLpro.
AKT (PKB) Substrate AKT (PKB) Substrate

AKT (PKB) Substrate

Reference: A05-58
€0.00 (tax incl.)
The AKT (PKB) Substrate peptide sequence (CKRPRAASFAE) is based on the N-terminus of GSK3.
AKT (SGK) Substrate AKT (SGK) Substrate

AKT (SGK) Substrate

Reference: A08-58
€0.00 (tax incl.)
The AKT (SGK) Substrate peptide sequence (RPRAATF) is based on the N-terminus of GSK3.
CK2 Substrate CK2 Substrate

CK2 Substrate

Reference: C08-58
€0.00 (tax incl.)
The synthetic peptide (RRRADDSDDDDD) contains serine protein kinase phosphorylation site surrounded by acidic residues and is high selectively evaluated as a substrate for CK2 family kinases.
GSK3 Substrate GSK3 Substrate

GSK3 Substrate

Reference: G50-58
€0.00 (tax incl.)
The GSK3 sub peptide sequence (YRRAAVPPSPSLSRHSSPHQ(pS)EDEEE) is based on human muscle glycogen synthase 1 (amino acid 636-661).
HER2 Substrate HER2 Substrate

HER2 Substrate

Reference: E27-58
€0.00 (tax incl.)
The HER2 Substrate synthetic peptide [AAEEIYAARRG] is routinely evaluated as a substrate for HER2.
Modified AKT Substrate Modified AKT Substrate

Modified AKT Substrate

Reference: A05-58B
€0.00 (tax incl.)
The Modified AKT Substrate peptide sequence (modified-CKRPRAASFAE) is based on the N-terminus of GSK3.
Modified AKT Substrate II Modified AKT Substrate II

Modified AKT Substrate II

Reference: A05-58C
€0.00 (tax incl.)
The Modified AKT Substrate II peptide sequence (modified-CKRPRAASFAE) is based on the N-terminus of GSK3.
Modified AXLtide Substrate Modified AXLtide Substrate

Modified AXLtide Substrate

Reference: A16-58B
€0.00 (tax incl.)
The Axltide peptide sequence (CKKSRGDYMTMQIG) is based on the mouse Insulin receptor substrate 1 (amino acid 979-989).
Modified PKA Substrate Modified PKA Substrate

Modified PKA Substrate

Reference: C01-58B
€0.00 (tax incl.)
The modified PKA Substrate peptide sequence (modified-CGRTGRRNSI-amide) is based on the cAMP-dependent protein kinase inhibitor alpha (amino acid 15-23).
p38 Substrate p38 Substrate

p38 Substrate

Reference: P03-58
€0.00 (tax incl.)
The synthetic peptide (IPTTPITTTYFFFKKK) contains serine/threonine protein kinase phosphorylation sites and is routinely evaluated as a substrate for p38 family kinases.
PKA Substrate PKA Substrate

PKA Substrate

Reference: C01-58
€0.00 (tax incl.)
The PKA sub peptide sequence (CGRTGRRNSI-amide) is based on the cAMP-dependent protein kinase inhibitor alpha (amino acid 15-23).
PLpro FRET Substrate PLpro FRET Substrate

PLpro FRET Substrate

Reference: PL01-58-500
€0.00 (tax incl.)
Synthetic FRET peptide substrate specific for PLpro.
PLpro FRET Substrate PLpro FRET Substrate

PLpro FRET Substrate

Reference: PL01-58-1000
€0.00 (tax incl.)
Synthetic FRET peptide substrate specific for PLpro.
PP1/PP2A Substrate PP1/PP2A Substrate

PP1/PP2A Substrate

Reference: P50-58-1000
€0.00 (tax incl.)
The PP1/PP2A Substrate peptide [GRPRTS(p)SFAEG] is derived from human GSK3b (glycogen synthase kinase-3 beta) (amino acids 3-13) and is suitable as PP1 and PP2A substrate.
PP2B Substrate PP2B Substrate

PP2B Substrate

Reference: P51-58-1000
€0.00 (tax incl.)
The PP2B Substrate peptide [DLDVPIPGRFDRRV(p)SVAAE] is derived from bovine PRKAR2A (cAMP-dependent protein kinase type II-alpha regulatory subunit) (amino acids 82-100) and is suitable as PP2B substrate.
RSK Substrate RSK Substrate

RSK Substrate

Reference: S06-58
€0.00 (tax incl.)
The RSK sub peptide sequence (KRRRLSSLRA) is based on human 40S ribosomal protein S6 (amino acid 230-239).
S6K Substrate S6K Substrate

S6K Substrate

Reference: S05-58
€0.00 (tax incl.)
The S6K sub peptide sequence (KRRRLASLR) is based on human 40S ribosomal protein S6 (amino acid 230-238).
SRC Substrate SRC Substrate

SRC Substrate

Reference: S30-58
€0.00 (tax incl.)
The SRC sub peptide sequence (KVEKIGEGTYGVVYK-amide) is based on the p34cdc2 (amino acid 6-20).
Tyrosine Kinase Substrate-3 Tyrosine Kinase Substrate-3

Tyrosine Kinase Substrate-3

Reference: T71-58
€0.00 (tax incl.)
The synthetic peptide Tyrosine Kinase Substrate-3 (RRLIEDAEYAARG) is derived from human SRC (amino acid 412-422) and considered to be a generic substrate for various protein tyrosine kinases.
DUB Substrate I DUB Substrate I

DUB Substrate I

Reference: U06-57-10
€0.00 (tax incl.)
The ubiquitin-based proluciferin substrate is based on the C-terminal derivative of Ubiquitin.
DUB Substrate II DUB Substrate II

DUB Substrate II

Reference: S293-57-10
€0.00 (tax incl.)
The SUMO1-based proluciferin substrate is based on the C-terminal derivative of SUMO1.
DUB Substrate III DUB Substrate III

DUB Substrate III

Reference: N263-57-10
€0.00 (tax incl.)
The NEDD8-based proluciferin substrate is based on the C-terminal derivative of NEDD8.
DNMT Substrate-1 DNMT Substrate-1

DNMT Substrate-1

Reference: D53-58-05
€0.00 (tax incl.)
The synthetic double-stranded oligonucleotide (Sense: 5’- GATCCGACGACGACGCGCGCGCGACGACGAGATC; Anti-sense: 5’- GATCTCGTCGTCGCGCGCGCGTCGTCGTCGGAC) is used as a substrate for DNA methyltransferase 3A (DNMT3A).
METTL3/METTL14 Substrate METTL3/METTL14 Substrate

METTL3/METTL14 Substrate

Reference: M323-58-025
€0.00 (tax incl.)
The synthetic single-stranded 27 base’s oligo ribo-nucleotide is used as a substrate for assay of methyltransferase METTL3/METTL14 complex.
Poly (1:1 dI, dC) Acid Poly (1:1 dI, dC) Acid

Poly (1:1 dI, dC) Acid

Reference: P62-58-25
€0.00 (tax incl.)
The synthetic poly (deoxyinosinic-deoxycytidylic) acid sodium salt – double-stranded polymer (synthesized as 1:1 ratio) is used as a substrate for DNA methyltransferases.
PI(3)P PI(3)P

PI(3)P

Reference: P421-59-05
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(3)P PI(3)P

PI(3)P

Reference: P421-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(3)P:PS PI(3)P:PS

PI(3)P:PS

Reference: P426-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(3)P:PS PI(3)P:PS

PI(3)P:PS

Reference: P426-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4)P PI(4)P

PI(4)P

Reference: P422-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4)P PI(4)P

PI(4)P

Reference: P422-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4)P:PS PI(4)P:PS

PI(4)P:PS

Reference: P427-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4)P:PS PI(4)P:PS

PI(4)P:PS

Reference: P427-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4,5)P2 PI(4,5)P2

PI(4,5)P2

Reference: P424-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4,5)P2 PI(4,5)P2

PI(4,5)P2

Reference: P424-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4,5)P2:PS PI(4,5)P2:PS

PI(4,5)P2:PS

Reference: P429-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4,5)P2:PS PI(4,5)P2:PS

PI(4,5)P2:PS

Reference: P429-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(5)P PI(5)P

PI(5)P

Reference: P423-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(5)P PI(5)P

PI(5)P

Reference: P423-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(5)P:PS PI(5)P:PS

PI(5)P:PS

Reference: P428-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(5)P:PS PI(5)P:PS

PI(5)P:PS

Reference: P428-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI:PS PI:PS

PI:PS

Reference: P425-59B-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI:PS PI:PS

PI:PS

Reference: P425-59B-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
D-Fructose-6-phosphate D-Fructose-6-phosphate

D-Fructose-6-phosphate

Reference: F520-59-10
€0.00 (tax incl.)
D-Fructose-6-phosphate (sodium salt hydrate) is supplied as a crystalline solid.
D-Glucose-6-phosphate D-Glucose-6-phosphate

D-Glucose-6-phosphate

Reference: F521-59-10 mg
€0.00 (tax incl.)
D-glucose-6-phosphate (sodium salt) is supplied as a crystalline solid.
2 | Photosynthesis Tool Kit - quantitation 2 | Photosynthesis Tool Kit - quantitation

2 | Photosynthesis Tool Kit - quantitation

Reference: AS04 051
€0.00 (tax incl.)
This kit allows quantitation of major photosynthetic proteins: Rubisco, PsaC (PSI) and PsbA (PSII) as well as determination of PSI/PSII ratios using the western blot technique. The kit contains following global...
2 | Rubisco quantitation kit 2 | Rubisco quantitation kit

2 | Rubisco quantitation kit

Reference: AS09 409
€0.00 (tax incl.)
The Rubisco quantitation kit is suitable for quantitation of Rubisco in plant and algal samples using quantitative immunoblotting. It contains anti-RbcL antibody, Rubisco protein standard and the Protein Extraction...
DNA Fragmentation Detection Kit (30 slides) DNA Fragmentation Detection Kit (30 slides)

DNA Fragmentation Detection Kit (30 slides)

Reference: AS20 4458
€0.00 (tax incl.)
Papain (EC=3.4.22.2) is a cysteine protease which belongs to peptidase C1 family. Can cause an allergic reaction in humans. Alternative names: Papaya proteinase I, allergen= Car p 1.
DNA Fragmentation Detection Kit (60 slides) DNA Fragmentation Detection Kit (60 slides)

DNA Fragmentation Detection Kit (60 slides)

Reference: AS20 4459
€0.00 (tax incl.)
Papain (EC=3.4.22.2) is a cysteine protease which belongs to peptidase C1 family. Can cause an allergic reaction in humans. Alternative names: Papaya proteinase I, allergen= Car p 1.
2 | Educational antibody kit - photosynthesis 2 | Educational antibody kit - photosynthesis

2 | Educational antibody kit - photosynthesis

Reference: AS05 070
€0.00 (tax incl.)
This kit contains antibodies to the following 5 proteins and 4 protein standards for their quantification. It also includes a matching secondary antibody and an ECL detection reagent.Rubisco - universal and absolutely...
Agrisera combination kit (primary+secondary+ECL) Agrisera combination kit (primary+secondary+ECL)

Agrisera combination kit (primary+secondary+ECL)

Reference: AS15 3074-set
€0.00 (tax incl.)
This kit allows you to test a suitable matching secondary antibody and the best ECL detection reagent that best suits your experiment.This kit contains the following products_Primary antibodyChoos your primary...
AgriseraECL Bright AgriseraECL Bright

AgriseraECL Bright

Reference: AS16 ECL-N
€0.00 (tax incl.)
AgriseraECL Bright for Western Blot detection is a high quality substrate for detection of horseradish peroxidase enzyme activity at low pico to mid femtogram levels. It's a ready to use 2 component system with low...
AgriseraECL SuperBright AgriseraECL SuperBright

AgriseraECL SuperBright

Reference: AS16 ECL-S
€0.00 (tax incl.)
AgriseraECL SuperBright for Western Blot detection is a high quality substrate for detection of horseradish peroxidase enzyme activity at extreme low femtogram levels, offering low background and superior signal to...
Agrisera ECL kit (Bright/SuperBright) Agrisera ECL kit (Bright/SuperBright)

Agrisera ECL kit (Bright/SuperBright)

Reference: AS16 ECL-S-N
€0.00 (tax incl.)
Agrisera ECL kit (Bright/SuperBright) is a Western Blot detection kit, that combines two chemiluminescent reagents with different detetion range for visualization of horseradish peroxidase enzyme activity.It is a...
AgriseraELISA SuperBright AgriseraELISA SuperBright

AgriseraELISA SuperBright

Reference: AS18 ELISA-ECL
€0.00 (tax incl.)
AgriseraELISA SuperBright is specially formulated for HRP microwell and ELISA system detection. It is a high quality substrate for detection of horseradish peroxidase enzyme activity at true extreme low femtogram...
Nitric Oxide Synthase Assay Kit Nitric Oxide Synthase Assay Kit

Nitric Oxide Synthase Assay Kit

Reference: ARG81188
€0.00 (tax incl.)
Nitric oxide is a reactive free radical which acts as a biologic mediator in several processes, including neurotransmission and antimicrobial and antitumoral activities. Nitric oxide is synthesized from L-arginine by...
Alkaline Phosphatase Activity Assay Kit (Colorimetric) Alkaline Phosphatase Activity Assay Kit (Colorimetric)

Alkaline Phosphatase Activity Assay Kit (Colorimetric)

Reference: ARG81239
€0.00 (tax incl.)
There are at least four distinct but related alkaline phosphatases: intestinal, placental, placental-like, and liver/bone/kidney (tissue non-specific). The first three are located together on chromosome 2, while the...
ALP / Alkaline Phosphatase Assay Kit ALP / Alkaline Phosphatase Assay Kit

ALP / Alkaline Phosphatase Assay Kit

Reference: ARG81296
€0.00 (tax incl.)
There are at least four distinct but related alkaline phosphatases: intestinal, placental, placental-like, and liver/bone/kidney (tissue non-specific). The first three are located together on chromosome 2, while the...
AST / Aspartate Transaminase Assay Kit AST / Aspartate Transaminase Assay Kit

AST / Aspartate Transaminase Assay Kit

Reference: ARG81297
€0.00 (tax incl.)
Glutamic-oxaloacetic transaminase is a pyridoxal phosphate-dependent enzyme which exists in cytoplasmic and mitochondrial forms, GOT1 and GOT2, respectively. GOT plays a role in amino acid metabolism and the urea and...
ALT / Alanine Transaminase Assay Kit ALT / Alanine Transaminase Assay Kit

ALT / Alanine Transaminase Assay Kit

Reference: ARG81298
€0.00 (tax incl.)
This gene encodes cytosolic alanine aminotransaminase 1 (ALT1); also known as glutamate-pyruvate transaminase 1. This enzyme catalyzes the reversible transamination between alanine and 2-oxoglutarate to generate...
Cell Cycle / Apoptosis Analysis Kit Cell Cycle / Apoptosis Analysis Kit

Cell Cycle / Apoptosis Analysis Kit

Reference: ARG81299
€0.00 (tax incl.)
The content of DNA is changed with the process of cell cycle. And the DNA can be stained by fluorescent dye to measure its intensity by flow cytometry to monitor the cell cycle distribution in G1, S, GS/M phase and as...

Menu

Settings

Please sign in first.

Sign in