Category: Research kits

Filter By
Brand: ApexBio Brand: Biosensis Brand: Cayman Chemical Brand: Microzone Brand: Signalchem Brand: Vazyme Clear all
DUB Substrate I DUB Substrate I

DUB Substrate I

Reference: U06-57-10
€0.00 (tax incl.)
The ubiquitin-based proluciferin substrate is based on the C-terminal derivative of Ubiquitin.
DUB Substrate II DUB Substrate II

DUB Substrate II

Reference: S293-57-10
€0.00 (tax incl.)
The SUMO1-based proluciferin substrate is based on the C-terminal derivative of SUMO1.
DUB Substrate III DUB Substrate III

DUB Substrate III

Reference: N263-57-10
€0.00 (tax incl.)
The NEDD8-based proluciferin substrate is based on the C-terminal derivative of NEDD8.
DNMT Substrate-1 DNMT Substrate-1

DNMT Substrate-1

Reference: D53-58-05
€0.00 (tax incl.)
The synthetic double-stranded oligonucleotide (Sense: 5’- GATCCGACGACGACGCGCGCGCGACGACGAGATC; Anti-sense: 5’- GATCTCGTCGTCGCGCGCGCGTCGTCGTCGGAC) is used as a substrate for DNA methyltransferase 3A (DNMT3A).
METTL3/METTL14 Substrate METTL3/METTL14 Substrate

METTL3/METTL14 Substrate

Reference: M323-58-025
€0.00 (tax incl.)
The synthetic single-stranded 27 base’s oligo ribo-nucleotide is used as a substrate for assay of methyltransferase METTL3/METTL14 complex.
Poly (1:1 dI, dC) Acid Poly (1:1 dI, dC) Acid

Poly (1:1 dI, dC) Acid

Reference: P62-58-25
€0.00 (tax incl.)
The synthetic poly (deoxyinosinic-deoxycytidylic) acid sodium salt – double-stranded polymer (synthesized as 1:1 ratio) is used as a substrate for DNA methyltransferases.
PI(3)P PI(3)P

PI(3)P

Reference: P421-59-05
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(3)P PI(3)P

PI(3)P

Reference: P421-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(3)P:PS PI(3)P:PS

PI(3)P:PS

Reference: P426-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(3)P:PS PI(3)P:PS

PI(3)P:PS

Reference: P426-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4)P PI(4)P

PI(4)P

Reference: P422-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4)P PI(4)P

PI(4)P

Reference: P422-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4)P:PS PI(4)P:PS

PI(4)P:PS

Reference: P427-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4)P:PS PI(4)P:PS

PI(4)P:PS

Reference: P427-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4,5)P2 PI(4,5)P2

PI(4,5)P2

Reference: P424-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4,5)P2 PI(4,5)P2

PI(4,5)P2

Reference: P424-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4,5)P2:PS PI(4,5)P2:PS

PI(4,5)P2:PS

Reference: P429-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4,5)P2:PS PI(4,5)P2:PS

PI(4,5)P2:PS

Reference: P429-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(5)P PI(5)P

PI(5)P

Reference: P423-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(5)P PI(5)P

PI(5)P

Reference: P423-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(5)P:PS PI(5)P:PS

PI(5)P:PS

Reference: P428-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(5)P:PS PI(5)P:PS

PI(5)P:PS

Reference: P428-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI:PS PI:PS

PI:PS

Reference: P425-59B-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI:PS PI:PS

PI:PS

Reference: P425-59B-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
D-Fructose-6-phosphate D-Fructose-6-phosphate

D-Fructose-6-phosphate

Reference: F520-59-10
€0.00 (tax incl.)
D-Fructose-6-phosphate (sodium salt hydrate) is supplied as a crystalline solid.
D-Glucose-6-phosphate D-Glucose-6-phosphate

D-Glucose-6-phosphate

Reference: F521-59-10 mg
€0.00 (tax incl.)
D-glucose-6-phosphate (sodium salt) is supplied as a crystalline solid.
CCK-8 Cell Counting Kit CCK-8 Cell Counting Kit

CCK-8 Cell Counting Kit

Reference: A311-01
€0.00 (tax incl.)
CCK-8 Cell Counting Kit, referred to as CCK-8 kit, is dependent on WST-8 (2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5- (2,4-Disulfobenzene)-2H-tetrazole monosodium salt) is a fast, highly sensitive,...
CCK-8 Cell Counting Kit CCK-8 Cell Counting Kit

CCK-8 Cell Counting Kit

Reference: A311-02
€0.00 (tax incl.)
CCK-8 Cell Counting Kit, referred to as CCK-8 kit, is dependent on WST-8 (2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5- (2,4-Disulfobenzene)-2H-tetrazole monosodium salt) is a fast, highly sensitive,...
Dual Luciferase Reporter Assay Kit Dual Luciferase Reporter Assay Kit

Dual Luciferase Reporter Assay Kit

Reference: DL101-01
€0.00 (tax incl.)
The Dual Luciferase Reporter Assay Kit is used to detect the fluorescence intensity of the Luciferin substrate after the reporter plasmid is transfected into the cells, so as to reflect the expression of luciferase...
Add&Read Human IgG Kit Add&Read Human IgG Kit

Add&Read Human IgG Kit

Reference: DD2101-01
€0.00 (tax incl.)
Add&ReadTM Human IgG Kit can be used to detect the concentration of Human IgG (hlgG) in the cell supernatant or after purification. There are two antibodies that recognize hIgG in the kit, namely: the antibody that...
Add&Read Human IgG Kit Add&Read Human IgG Kit

Add&Read Human IgG Kit

Reference: DD2101-02
€0.00 (tax incl.)
Add&ReadTM Human IgG Kit can be used to detect the concentration of Human IgG (hlgG) in the cell supernatant or after purification. There are two antibodies that recognize hIgG in the kit, namely: the antibody that...
Add&Read Human Fc Kit Add&Read Human Fc Kit

Add&Read Human Fc Kit

Reference: DD2102-01
€0.00 (tax incl.)
Add&ReadTM Human Fc Kit can be used to detect the concentration of Human IgG or hFc-fusion protein (hFc-fusion protien) in the cell supernatant or after purification. There is an antibody in the kit that recognizes...
Add&Read Human Fc Kit Add&Read Human Fc Kit

Add&Read Human Fc Kit

Reference: DD2102-02
€0.00 (tax incl.)
Add&ReadTM Human Fc Kit can be used to detect the concentration of Human IgG or hFc-fusion protein (hFc-fusion protien) in the cell supernatant or after purification. There is an antibody in the kit that recognizes...
BCA Protein Quantification Kit BCA Protein Quantification Kit

BCA Protein Quantification Kit

Reference: E112-01
€0.00 (tax incl.)
The BCA Protein Quantification Kit is currently one of the most sensitive protein determination methods. Under alkaline conditions, the protein reduces Cu2+ to Cu+, and Cu+ interacts with the unique BCA Reagent A...
BCA Protein Quantification Kit BCA Protein Quantification Kit

BCA Protein Quantification Kit

Reference: E112-02
€0.00 (tax incl.)
The BCA Protein Quantification Kit is currently one of the most sensitive protein determination methods. Under alkaline conditions, the protein reduces Cu2+ to Cu+, and Cu+ interacts with the unique BCA Reagent A...

Menu

Settings

Please sign in first.

Sign in