Category: Research kits

Reference: N263-57-10
€0.00 (tax incl.)
The NEDD8-based proluciferin substrate is based on the C-terminal derivative of NEDD8.
Reference: D53-58-05
€0.00 (tax incl.)
The synthetic double-stranded oligonucleotide (Sense: 5’- GATCCGACGACGACGCGCGCGCGACGACGAGATC; Anti-sense: 5’- GATCTCGTCGTCGCGCGCGCGTCGTCGTCGGAC) is used as a substrate for DNA methyltransferase 3A (DNMT3A).
Reference: M323-58-025
€0.00 (tax incl.)
The synthetic single-stranded 27 base’s oligo ribo-nucleotide is used as a substrate for assay of methyltransferase METTL3/METTL14 complex.
Reference: P62-58-25
€0.00 (tax incl.)
The synthetic poly (deoxyinosinic-deoxycytidylic) acid sodium salt – double-stranded polymer (synthesized as 1:1 ratio) is used as a substrate for DNA methyltransferases.
Reference: P421-59-05
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P421-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P426-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P426-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P422-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P422-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P427-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P427-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P424-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P424-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P429-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P429-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P423-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P423-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P428-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P428-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P425-59B-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P425-59B-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: F520-59-10
€0.00 (tax incl.)
D-Fructose-6-phosphate (sodium salt hydrate) is supplied as a crystalline solid.
Reference: F521-59-10 mg
€0.00 (tax incl.)
D-glucose-6-phosphate (sodium salt) is supplied as a crystalline solid.
Reference: 0103004-D2
€0.00 (tax incl.)
Detection Buffer C&D for membrane-based Antibody Array Kits (8 array supply).
Reference: 0103004-W
€0.00 (tax incl.)
20X Wash Buffer I and II for Antibody Array Kits, (20 ml each)
Reference: 255-10001-1
€0.00 (tax incl.)
0.15 M MOPS, pH 7.5, 0.22 u filtered. Buffer concentrate used to buffer the constituted Leibovitz L-15 media in Hepatocyte Isolation System.
Reference: RP10238K
€0.00 (tax incl.)
Caspase-8, 10 Activity Fluorometric Assay Kit can be used for assaying caspase-8, 10, 3, 7 activities in cell/tissue extracts in a 96-well plate format. Each of the supplied fluorogenic substrate and the pan caspase...
Reference: 137-00020
€0.00 (tax incl.)
The RayBio® Human TBNK Flow Cytometry Kit is designed to determine the percentages and absolute counts of mature human lymphocyte subsets in peripheral whole blood (WB). The subsets include T lymphocytes (CD3⁺),...
Reference: 137-00021
€0.00 (tax incl.)
The RayBio® Human TBMNK Flow Cytometry Kit is designed to determine the percentages of mature human lymphocyte and monocyte subsets in peripheral whole blood (WB).
Reference: 137-08010
€0.00 (tax incl.)
The RayBiotech Annexin V Detection Kit is a sensitive assay for detection of cell apoptosis by flow cytometry.

Menu

Settings