Category: Research kits

Filter By
Brand: Abclonal Brand: Biovendor Brand: Cayman Chemical Brand: FineTest Brand: Raybiotech Brand: Signalchem Clear all
Lipid Dilution Buffer Lipid Dilution Buffer

Lipid Dilution Buffer

Reference: L21-09-01
€0.00 (tax incl.)
The working solution used for diluting lipid substrates.
Lipid Dilution Buffer Lipid Dilution Buffer

Lipid Dilution Buffer

Reference: L21-09-05
€0.00 (tax incl.)
The working solution used for diluting lipid substrates.
Lipid Dilution Buffer Lipid Dilution Buffer

Lipid Dilution Buffer

Reference: L21-09-20
€0.00 (tax incl.)
The working solution used for diluting lipid substrates.
Lipid Kinase Buffer Lipid Kinase Buffer

Lipid Kinase Buffer

Reference: L01-09-01
€0.00 (tax incl.)
The 5x stock solution of buffer used for assaying lipid kinase proteins.
Lipid Kinase Buffer Lipid Kinase Buffer

Lipid Kinase Buffer

Reference: L01-09-05
€0.00 (tax incl.)
The 5x stock solution of buffer used for assaying lipid kinase proteins.
Lipid Kinase Buffer Lipid Kinase Buffer

Lipid Kinase Buffer

Reference: L01-09-20
€0.00 (tax incl.)
The 5x stock solution of buffer used for assaying lipid kinase proteins.
MnCl2 Solution MnCl2 Solution

MnCl2 Solution

Reference: M40-09-25
€0.00 (tax incl.)
25μl volume of 2.5M MnCl2 solution for different enzyme assays.
Neddylation Buffer Neddylation Buffer

Neddylation Buffer

Reference: N01-09-01
€0.00 (tax incl.)
Stock solution of buffer used for assaying ubiquitin enzymes.
Neddylation Buffer Neddylation Buffer

Neddylation Buffer

Reference: N01-09-05
€0.00 (tax incl.)
Stock solution of buffer used for assaying ubiquitin enzymes.
Neddylation Buffer Neddylation Buffer

Neddylation Buffer

Reference: N01-09-20
€0.00 (tax incl.)
Stock solution of buffer used for assaying ubiquitin enzymes.
PKC Lipid Activator, 10x PKC Lipid Activator, 10x

PKC Lipid Activator, 10x

Reference: L51-39-500
€0.00 (tax incl.)
10x stock solution used for assaying protein kinase activity of PKC family members. Vortex or sonicate prior to use.
3CLpro FRET Substrate 3CLpro FRET Substrate

3CLpro FRET Substrate

Reference: CL01-58-500
€0.00 (tax incl.)
Synthetic FRET peptide substrate specific for 3CLpro.
3CLpro FRET Substrate 3CLpro FRET Substrate

3CLpro FRET Substrate

Reference: CL01-58-1000
€0.00 (tax incl.)
Synthetic FRET peptide substrate specific for 3CLpro.
AKT (PKB) Substrate AKT (PKB) Substrate

AKT (PKB) Substrate

Reference: A05-58
€0.00 (tax incl.)
The AKT (PKB) Substrate peptide sequence (CKRPRAASFAE) is based on the N-terminus of GSK3.
AKT (SGK) Substrate AKT (SGK) Substrate

AKT (SGK) Substrate

Reference: A08-58
€0.00 (tax incl.)
The AKT (SGK) Substrate peptide sequence (RPRAATF) is based on the N-terminus of GSK3.
CK2 Substrate CK2 Substrate

CK2 Substrate

Reference: C08-58
€0.00 (tax incl.)
The synthetic peptide (RRRADDSDDDDD) contains serine protein kinase phosphorylation site surrounded by acidic residues and is high selectively evaluated as a substrate for CK2 family kinases.
GSK3 Substrate GSK3 Substrate

GSK3 Substrate

Reference: G50-58
€0.00 (tax incl.)
The GSK3 sub peptide sequence (YRRAAVPPSPSLSRHSSPHQ(pS)EDEEE) is based on human muscle glycogen synthase 1 (amino acid 636-661).
HER2 Substrate HER2 Substrate

HER2 Substrate

Reference: E27-58
€0.00 (tax incl.)
The HER2 Substrate synthetic peptide [AAEEIYAARRG] is routinely evaluated as a substrate for HER2.
Modified AKT Substrate Modified AKT Substrate

Modified AKT Substrate

Reference: A05-58B
€0.00 (tax incl.)
The Modified AKT Substrate peptide sequence (modified-CKRPRAASFAE) is based on the N-terminus of GSK3.
Modified AKT Substrate II Modified AKT Substrate II

Modified AKT Substrate II

Reference: A05-58C
€0.00 (tax incl.)
The Modified AKT Substrate II peptide sequence (modified-CKRPRAASFAE) is based on the N-terminus of GSK3.
Modified AXLtide Substrate Modified AXLtide Substrate

Modified AXLtide Substrate

Reference: A16-58B
€0.00 (tax incl.)
The Axltide peptide sequence (CKKSRGDYMTMQIG) is based on the mouse Insulin receptor substrate 1 (amino acid 979-989).
Modified PKA Substrate Modified PKA Substrate

Modified PKA Substrate

Reference: C01-58B
€0.00 (tax incl.)
The modified PKA Substrate peptide sequence (modified-CGRTGRRNSI-amide) is based on the cAMP-dependent protein kinase inhibitor alpha (amino acid 15-23).
p38 Substrate p38 Substrate

p38 Substrate

Reference: P03-58
€0.00 (tax incl.)
The synthetic peptide (IPTTPITTTYFFFKKK) contains serine/threonine protein kinase phosphorylation sites and is routinely evaluated as a substrate for p38 family kinases.
PKA Substrate PKA Substrate

PKA Substrate

Reference: C01-58
€0.00 (tax incl.)
The PKA sub peptide sequence (CGRTGRRNSI-amide) is based on the cAMP-dependent protein kinase inhibitor alpha (amino acid 15-23).
PLpro FRET Substrate PLpro FRET Substrate

PLpro FRET Substrate

Reference: PL01-58-500
€0.00 (tax incl.)
Synthetic FRET peptide substrate specific for PLpro.
PLpro FRET Substrate PLpro FRET Substrate

PLpro FRET Substrate

Reference: PL01-58-1000
€0.00 (tax incl.)
Synthetic FRET peptide substrate specific for PLpro.
PP1/PP2A Substrate PP1/PP2A Substrate

PP1/PP2A Substrate

Reference: P50-58-1000
€0.00 (tax incl.)
The PP1/PP2A Substrate peptide [GRPRTS(p)SFAEG] is derived from human GSK3b (glycogen synthase kinase-3 beta) (amino acids 3-13) and is suitable as PP1 and PP2A substrate.
PP2B Substrate PP2B Substrate

PP2B Substrate

Reference: P51-58-1000
€0.00 (tax incl.)
The PP2B Substrate peptide [DLDVPIPGRFDRRV(p)SVAAE] is derived from bovine PRKAR2A (cAMP-dependent protein kinase type II-alpha regulatory subunit) (amino acids 82-100) and is suitable as PP2B substrate.
RSK Substrate RSK Substrate

RSK Substrate

Reference: S06-58
€0.00 (tax incl.)
The RSK sub peptide sequence (KRRRLSSLRA) is based on human 40S ribosomal protein S6 (amino acid 230-239).
S6K Substrate S6K Substrate

S6K Substrate

Reference: S05-58
€0.00 (tax incl.)
The S6K sub peptide sequence (KRRRLASLR) is based on human 40S ribosomal protein S6 (amino acid 230-238).
SRC Substrate SRC Substrate

SRC Substrate

Reference: S30-58
€0.00 (tax incl.)
The SRC sub peptide sequence (KVEKIGEGTYGVVYK-amide) is based on the p34cdc2 (amino acid 6-20).
Tyrosine Kinase Substrate-3 Tyrosine Kinase Substrate-3

Tyrosine Kinase Substrate-3

Reference: T71-58
€0.00 (tax incl.)
The synthetic peptide Tyrosine Kinase Substrate-3 (RRLIEDAEYAARG) is derived from human SRC (amino acid 412-422) and considered to be a generic substrate for various protein tyrosine kinases.
DUB Substrate I DUB Substrate I

DUB Substrate I

Reference: U06-57-10
€0.00 (tax incl.)
The ubiquitin-based proluciferin substrate is based on the C-terminal derivative of Ubiquitin.
DUB Substrate II DUB Substrate II

DUB Substrate II

Reference: S293-57-10
€0.00 (tax incl.)
The SUMO1-based proluciferin substrate is based on the C-terminal derivative of SUMO1.
DUB Substrate III DUB Substrate III

DUB Substrate III

Reference: N263-57-10
€0.00 (tax incl.)
The NEDD8-based proluciferin substrate is based on the C-terminal derivative of NEDD8.
DNMT Substrate-1 DNMT Substrate-1

DNMT Substrate-1

Reference: D53-58-05
€0.00 (tax incl.)
The synthetic double-stranded oligonucleotide (Sense: 5’- GATCCGACGACGACGCGCGCGCGACGACGAGATC; Anti-sense: 5’- GATCTCGTCGTCGCGCGCGCGTCGTCGTCGGAC) is used as a substrate for DNA methyltransferase 3A (DNMT3A).
METTL3/METTL14 Substrate METTL3/METTL14 Substrate

METTL3/METTL14 Substrate

Reference: M323-58-025
€0.00 (tax incl.)
The synthetic single-stranded 27 base’s oligo ribo-nucleotide is used as a substrate for assay of methyltransferase METTL3/METTL14 complex.
Poly (1:1 dI, dC) Acid Poly (1:1 dI, dC) Acid

Poly (1:1 dI, dC) Acid

Reference: P62-58-25
€0.00 (tax incl.)
The synthetic poly (deoxyinosinic-deoxycytidylic) acid sodium salt – double-stranded polymer (synthesized as 1:1 ratio) is used as a substrate for DNA methyltransferases.
PI(3)P PI(3)P

PI(3)P

Reference: P421-59-05
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.

Menu

Settings

Please sign in first.

Sign in