RSK Substrate Reference: S06-58 The RSK sub peptide sequence (KRRRLSSLRA) is based on human 40S ribosomal protein S6 (amino acid 230-239).
S6K Substrate Reference: S05-58 The S6K sub peptide sequence (KRRRLASLR) is based on human 40S ribosomal protein S6 (amino acid 230-238).
SRC Substrate Reference: S30-58 The SRC sub peptide sequence (KVEKIGEGTYGVVYK-amide) is based on the p34cdc2 (amino acid 6-20).
Tyrosine Kinase Substrate-3 Reference: T71-58 The synthetic peptide Tyrosine Kinase Substrate-3 (RRLIEDAEYAARG) is derived from human SRC (amino acid 412-422) and considered to be a generic substrate for various protein tyrosine kinases.
DUB Substrate I Reference: U06-57-10 The ubiquitin-based proluciferin substrate is based on the C-terminal derivative of Ubiquitin.
DUB Substrate II Reference: S293-57-10 The SUMO1-based proluciferin substrate is based on the C-terminal derivative of SUMO1.
DUB Substrate III Reference: N263-57-10 The NEDD8-based proluciferin substrate is based on the C-terminal derivative of NEDD8.
DNMT Substrate-1 Reference: D53-58-05 The synthetic double-stranded oligonucleotide (Sense: 5’- GATCCGACGACGACGCGCGCGCGACGACGAGATC; Anti-sense: 5’- GATCTCGTCGTCGCGCGCGCGTCGTCGTCGGAC) is used as a substrate for DNA methyltransferase 3A (DNMT3A).
METTL3/METTL14 Substrate Reference: M323-58-025 The synthetic single-stranded 27 base’s oligo ribo-nucleotide is used as a substrate for assay of methyltransferase METTL3/METTL14 complex.
Poly (1:1 dI, dC) Acid Reference: P62-58-25 The synthetic poly (deoxyinosinic-deoxycytidylic) acid sodium salt – double-stranded polymer (synthesized as 1:1 ratio) is used as a substrate for DNA methyltransferases.
DLG (Dilauroyl-sn-glycerol) Reference: D430-59-200 The substrate solution used for assaying Diacylglycerol kinases.
DLG (Dilauroyl-sn-glycerol) Reference: D430-59-500 The substrate solution used for assaying Diacylglycerol kinases.