Category: Research kits

Active filters

  • Brand: Boster
  • Brand: Invent
  • Brand: Mabtech
  • Brand: Microzone
  • Brand: Signalchem
Reference: S06-58

The RSK sub peptide sequence (KRRRLSSLRA) is based on human 40S ribosomal protein S6 (amino acid 230-239).

Reference: S05-58

The S6K sub peptide sequence (KRRRLASLR) is based on human 40S ribosomal protein S6 (amino acid 230-238).

Reference: S30-58

The SRC sub peptide sequence (KVEKIGEGTYGVVYK-amide) is based on the p34cdc2 (amino acid 6-20).

Reference: T71-58

The synthetic peptide Tyrosine Kinase Substrate-3 (RRLIEDAEYAARG) is derived from human SRC (amino acid 412-422) and considered to be a generic substrate for various protein tyrosine kinases.

Reference: U06-57-10

The ubiquitin-based proluciferin substrate is based on the C-terminal derivative of Ubiquitin.

Reference: S293-57-10

The SUMO1-based proluciferin substrate is based on the C-terminal derivative of SUMO1.

Reference: N263-57-10

The NEDD8-based proluciferin substrate is based on the C-terminal derivative of NEDD8.

Reference: D53-58-05

The synthetic double-stranded oligonucleotide (Sense: 5’- GATCCGACGACGACGCGCGCGCGACGACGAGATC; Anti-sense: 5’- GATCTCGTCGTCGCGCGCGCGTCGTCGTCGGAC) is used as a substrate for DNA methyltransferase 3A (DNMT3A).

Reference: M323-58-025

The synthetic single-stranded 27 base’s oligo ribo-nucleotide is used as a substrate for assay of methyltransferase METTL3/METTL14 complex.

Reference: P62-58-25

The synthetic poly (deoxyinosinic-deoxycytidylic) acid sodium salt – double-stranded polymer (synthesized as 1:1 ratio) is used as a substrate for DNA methyltransferases.